ABCF3 | GeneID:424950 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 424950 Official Symbol ABCF3
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family F (GCN20), member 3
Description ATP-binding cassette, sub-family F (GCN20), member 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22784

ID Symbol Protein Species
GeneID:27406 Abcf3 NP_038880.1 Mus musculus
GeneID:40131 CG9330 NP_649129.1 Drosophila melanogaster
GeneID:55324 ABCF3 NP_060828.2 Homo sapiens
GeneID:175873 abcf-3 NP_498339.1 Caenorhabditis elegans
GeneID:287982 Abcf3 NP_001011896.1 Rattus norvegicus
GeneID:424950 ABCF3 XP_422757.2 Gallus gallus
GeneID:460884 ABCF3 XP_516910.2 Pan troglodytes
GeneID:478651 ABCF3 XP_859024.1 Canis lupus familiaris
GeneID:530975 ABCF3 XP_001252189.1 Bos taurus
GeneID:842763 ATGCN3 NP_176636.1 Arabidopsis thaliana
GeneID:850561 GCN20 NP_116664.1 Saccharomyces cerevisiae
GeneID:1267735 ENSANGG00000000043 XP_306294.2 Anopheles gambiae
GeneID:1280669 AgaP_AGAP012005 XP_320530.2 Anopheles gambiae
GeneID:2540597 SPBC29A3.09c NP_595837.1 Schizosaccharomyces pombe
GeneID:2705213 NCU04051.1 XP_323370.1 Neurospora crassa
GeneID:2896717 KLLA0A10857g XP_451473.1 Kluyveromyces lactis
GeneID:4331217 Os02g0826500 NP_001048587.1 Oryza sativa
GeneID:4621026 AGOS_AEL032W NP_984829.1 Eremothecium gossypii
GeneID:5050704 MGG_11547 XP_001411010.1 Magnaporthe grisea
GeneID:100149614 LOC100149614 XP_001922895.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_422757 XP_422757

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000013818 MI0005059 bta-miR-342 UCUCACACAGAAAUCGCACCCAUCU
ENSGALT00000013818 MI0001258 gga-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSGALT00000013818 MI0001244 gga-miR-126 UCGUACCGUGAGUAAUAAUGCGC
ENSGALT00000013818 MI0001173 gga-miR-99a AACCCGUAGAUCCGAUCUUGUG
ENSGALT00000013818 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENSGALT00000013818 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENSGALT00000013818 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSGALT00000013818 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSGALT00000013818 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSGALT00000013818 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSGALT00000013818 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSGALT00000013818 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSGALT00000013818 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSGALT00000013818 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_422757  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene