ABCC5 | GeneID:424947 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 424947 Official Symbol ABCC5
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21164

ID Symbol Protein Species
GeneID:10057 ABCC5 NP_005679.2 Homo sapiens
GeneID:27416 Abcc5 NP_038818.2 Mus musculus
GeneID:116721 Abcc5 NP_446376.1 Rattus norvegicus
GeneID:181587 mrp-5 NP_510479.1 Caenorhabditis elegans
GeneID:424947 ABCC5 XP_422754.2 Gallus gallus
GeneID:478648 ABCC5 XP_857354.1 Canis lupus familiaris
GeneID:511769 ABCC5 XP_001251891.1 Bos taurus
GeneID:796249 LOC796249 XP_001333981.2 Danio rerio
GeneID:4329047 Os02g0288400 NP_001046583.1 Oryza sativa
GeneID:4329049 Os02g0288700 NP_001046585.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_422754 XP_422754

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000013625 MI0005463 bta-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSGALT00000013625 MI0001175 gga-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSGALT00000013625 MI0001244 gga-miR-126 UCGUACCGUGAGUAAUAAUGCGC
ENSGALT00000013625 MI0001241 gga-miR-130a CAGUGCAAUAUUAAAAGGGCAU
ENSGALT00000013625 MI0001239 gga-miR-130b CAGUGCAAUAAUGAAAGGGCGU
ENSGALT00000013625 MI0001169 gga-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSGALT00000013625 MI0001231 gga-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSGALT00000013625 MI0001264 gga-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSGALT00000013625 MI0001229 gga-miR-140 AGUGGUUUUACCCUAUGGUAG
ENSGALT00000013625 MI0003695 gga-miR-146b UGAGAACUGAAUUCCAUAGGCG
ENSGALT00000013625 MI0001178 gga-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENSGALT00000013625 MI0001177 gga-miR-222 AGCUACAUCUGGCUACUGGGUCUC
ENSGALT00000013625 MI0001240 gga-miR-301 CAGUGCAAUAAUAUUGUCAAAGCAU
ENSGALT00000013625 MI0001211 gga-miR-302a AAGUGCUUCCAUGUUUUAGUGA
ENSGALT00000013625 MI0001199 gga-miR-30b UGUAAACAUCCUACACUCAGCU
ENSGALT00000013625 MI0001205 gga-miR-30c UGUAAACAUCCUACACUCUCAGCU
ENSGALT00000013625 MI0001257 gga-miR-30c UGUAAACAUCCUACACUCUCAGCU
ENSGALT00000013625 MI0003713 gga-miR-466 AUAUAUACACACACACAUAAGAC
ENSGALT00000013625 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSGALT00000013625 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENSGALT00000013625 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENSGALT00000013625 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENSGALT00000013625 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSGALT00000013625 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSGALT00000013625 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSGALT00000013625 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSGALT00000013625 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSGALT00000013625 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENSGALT00000013625 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSGALT00000013625 MI0003574 hsa-miR-568 AUGUAUAAAUGUAUACACAC
ENSGALT00000013625 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSGALT00000013625 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSGALT00000013625 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENSGALT00000013625 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSGALT00000013625 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSGALT00000013625 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENSGALT00000013625 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSGALT00000013625 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSGALT00000013625 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_422754  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene