ABHD7 | GeneID:424505 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 424505 Official Symbol ABHD7
Locus N/A Gene Type protein-coding
Synonyms
Full Name abhydrolase domain containing 7
Description abhydrolase domain containing 7
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 62402

ID Symbol Protein Species
GeneID:175239 ceeh-1 NP_497268.1 Caenorhabditis elegans
GeneID:179444 hydrolase NP_505662.1 Caenorhabditis elegans
GeneID:253152 ABHD7 NP_775838.2 Homo sapiens
GeneID:289440 Abhd7 XP_213993.3 Rattus norvegicus
GeneID:384214 Abhd7 NP_001001804.2 Mus musculus
GeneID:424505 ABHD7 XP_422345.2 Gallus gallus
GeneID:490160 ABHD7 XP_547281.2 Canis lupus familiaris
GeneID:524246 ABHD7 NP_001069323.1 Bos taurus
GeneID:566476 LOC566476 XP_694838.2 Danio rerio
GeneID:739732 ABHD7 XP_001152592.1 Pan troglodytes
GeneID:1280698 AgaP_AGAP011972 XP_320560.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_422345 XP_422345

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000009690 MI0005069 bta-miR-363 AUUGCACGGUAUCCAUCUGCG
ENSGALT00000009690 MI0005023 bta-miR-545 AUCAACAAACAUUUAUUGUGUG
ENSGALT00000009690 MI0001270 gga-miR-101 GUACAGUACUGUGAUAACUGAA
ENSGALT00000009690 MI0007558 gga-miR-101 GUACAGUACUGUGAUAACUGAA
ENSGALT00000009690 MI0001197 gga-miR-124a UUAAGGCACGCGGUGAAUGCCA
ENSGALT00000009690 MI0008210 gga-miR-124a UUAAGGCACGCGGUGAAUGCCA
ENSGALT00000009690 MI0004996 gga-miR-144 CUACAGUAUAGAUGAUGUACUC
ENSGALT00000009690 MI0001189 gga-miR-148a UCAGUGCACUACAGAACUUUGU
ENSGALT00000009690 MI0001240 gga-miR-301 CAGUGCAAUAAUAUUGUCAAAGCAU
ENSGALT00000009690 MI0001194 gga-miR-32 UAUUGCACAUUACUAAGUUGC
ENSGALT00000009690 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSGALT00000009690 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSGALT00000009690 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENSGALT00000009690 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSGALT00000009690 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSGALT00000009690 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSGALT00000009690 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSGALT00000009690 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSGALT00000009690 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSGALT00000009690 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSGALT00000009690 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSGALT00000009690 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSGALT00000009690 MI0003574 hsa-miR-568 AUGUAUAAAUGUAUACACAC
ENSGALT00000009690 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSGALT00000009690 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSGALT00000009690 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSGALT00000009690 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENSGALT00000009690 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSGALT00000009690 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_422345  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene