ABCA4 | GeneID:424490 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 424490 Official Symbol ABCA4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 4
Chromosome N/A
Also Known As ATP-binding cassette sub-family A member 4
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 298

ID Symbol Protein Species
GeneID:24 ABCA4 NP_000341.2 Homo sapiens
GeneID:11304 Abca4 NP_031404.1 Mus musculus
GeneID:171782 abt-2 NP_490949.3 Caenorhabditis elegans
GeneID:281584 ABCA4 NP_776646.1 Bos taurus
GeneID:310836 Abca4 XP_241525.3 Rattus norvegicus
GeneID:424490 ABCA4 XP_422330.2 Gallus gallus
GeneID:444852 ABCA4 NP_001003360.2 Canis lupus familiaris
GeneID:555506 LOC555506 XP_683123.3 Danio rerio
GeneID:745972 ABCA4 XP_001152577.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding
GO:0004012 Function phospholipid-translocating ATPase activity
GO:0005548 Function phospholipid transporter activity
GO:0006649 Process phospholipid transfer to membrane
GO:0045494 Process photoreceptor cell maintenance

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_422330 XP_422330

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000009238 MI0001200 gga-miR-216 UAAUCUCAGCUGGCAACUGUG
ENSGALT00000009238 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSGALT00000009238 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSGALT00000009238 MI0003136 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENSGALT00000009238 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENSGALT00000009238 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSGALT00000009238 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSGALT00000009238 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSGALT00000009238 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSGALT00000009238 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENSGALT00000009238 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSGALT00000009238 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSGALT00000009238 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENSGALT00000009238 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSGALT00000009238 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSGALT00000009238 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSGALT00000009238 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSGALT00000009238 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSGALT00000009238 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_422330  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Paton IR, et al. (2003) "Mapping the ABCA4, IMPDH2 and TIMP3 genes in chicken." Anim Genet. 34(5):395-396. PMID:14510686