ABCD3 | GeneID:424487 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 424487 Official Symbol ABCD3
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family D (ALD), member 3
Description ATP-binding cassette, sub-family D (ALD), member 3
Chromosome N/A
Also Known As ATP-binding cassette, sub-family D, member 3
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2140

ID Symbol Protein Species
GeneID:5825 ABCD3 NP_002849.1 Homo sapiens
GeneID:19299 Abcd3 NP_033017.2 Mus musculus
GeneID:25270 Abcd3 NP_036936.1 Rattus norvegicus
GeneID:32992 CG12703 NP_608354.1 Drosophila melanogaster
GeneID:174126 pmp-1 NP_495407.1 Caenorhabditis elegans
GeneID:174127 pmp-2 NP_495408.1 Caenorhabditis elegans
GeneID:406803 abcd3a NP_998647.1 Danio rerio
GeneID:424487 ABCD3 NP_001012615.1 Gallus gallus
GeneID:457037 ABCD3 XP_513575.2 Pan troglodytes
GeneID:479939 ABCD3 XP_537064.2 Canis lupus familiaris
GeneID:526059 ABCD3 XP_604418.3 Bos taurus
GeneID:830144 PXA1 NP_568072.1 Arabidopsis thaliana
GeneID:1271802 AgaP_AGAP000440 XP_310656.2 Anopheles gambiae
GeneID:4337574 Os05g0107600 NP_001054425.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab28499 PMP70 antibody (Biotin) (ab28499); Rabbit polyclonal to PMP70 - Peroxisomal Membrane Marker (Biotin)

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005743 Component mitochondrial inner membrane
GO:0005739 Component mitochondrion
GO:0005778 Component peroxisomal membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001012597 NP_001012615

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000009059 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENSGALT00000009059 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098