ABI2 | GeneID:424108 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 424108 Official Symbol ABI2
Locus N/A Gene Type protein-coding
Synonyms
Full Name abl interactor 2
Description abl interactor 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4209

ID Symbol Protein Species
GeneID:10152 ABI2 NP_005750.4 Homo sapiens
GeneID:41718 Abi NP_001097785.1 Drosophila melanogaster
GeneID:175789 abi-1 NP_498224.1 Caenorhabditis elegans
GeneID:286928 Abi2 NP_775166.1 Rattus norvegicus
GeneID:329165 Abi2 NP_937760.1 Mus musculus
GeneID:424108 ABI2 XP_001232729.1 Gallus gallus
GeneID:459892 ABI2 XP_001173251.1 Pan troglodytes
GeneID:692331 zgc:136560 NP_001038762.1 Danio rerio
GeneID:1278655 AgaP_AGAP001046 XP_318274.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000014182 MI0001191 gga-miR-138 AGCUGGUGUUGUGAAUC
ENSGALT00000014182 MI0001228 gga-miR-138 AGCUGGUGUUGUGAAUC
ENSGALT00000014182 MI0001184 gga-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSGALT00000014182 MI0001267 gga-miR-205a UCCUUCAUUCCACCGGAGUCUG
ENSGALT00000014182 MI0001238 gga-miR-205b CCCUUCAUUCCACCGGAAUCUG
ENSGALT00000014182 MI0001208 gga-miR-223 UGUCAGUUUGUCAAAUACCCC
ENSGALT00000014182 MI0004997 gga-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSGALT00000014182 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSGALT00000014182 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENSGALT00000014182 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSGALT00000014182 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSGALT00000014182 MI0002469 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC
ENSGALT00000014182 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENSGALT00000014182 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSGALT00000014182 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENSGALT00000014182 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSGALT00000014182 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSGALT00000014182 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSGALT00000014182 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENSGALT00000014182 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene