ABCG2 | GeneID:423767 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 423767 Official Symbol ABCG2
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family G (WHITE), member 2
Description ATP-binding cassette, sub-family G (WHITE), member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55852

ID Symbol Protein Species
GeneID:9429 ABCG2 NP_004818.2 Homo sapiens
GeneID:26357 Abcg2 NP_036050.1 Mus musculus
GeneID:312382 Abcg2 NP_852046.1 Rattus norvegicus
GeneID:423767 ABCG2 XP_421638.2 Gallus gallus
GeneID:471251 ABCG2 XP_526633.2 Pan troglodytes
GeneID:478472 ABCG2 XP_535650.2 Canis lupus familiaris
GeneID:536203 ABCG2 NP_001032555.2 Bos taurus
GeneID:735310 abcg2d NP_001036237.1 Danio rerio
GeneID:811826 PF14_0244 XP_001348418.1 Plasmodium falciparum
GeneID:830541 AT5G06530 NP_850781.2 Arabidopsis thaliana
GeneID:850369 ADP1 NP_009937.2 Saccharomyces cerevisiae
GeneID:2679509 MGG_01563 XP_363637.2 Magnaporthe grisea
GeneID:2713604 NCU02544.1 XP_331743.1 Neurospora crassa
GeneID:2892892 KLLA0D04554g XP_453265.1 Kluyveromyces lactis
GeneID:4331674 Os03g0157400 NP_001049014.1 Oryza sativa
GeneID:4621257 AGOS_AER190W NP_985047.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_421638 XP_421638

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000040097 MI0005034 bta-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENSGALT00000040097 MI0005022 bta-miR-487a AAUCAUACAGGGACAUCCAGU
ENSGALT00000040097 MI0005060 bta-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSGALT00000040097 MI0001252 gga-miR-124b UUAAGGCACGCAGUGAAUGCCA
ENSGALT00000040097 MI0001253 gga-miR-124b UUAAGGCACGCAGUGAAUGCCA
ENSGALT00000040097 MI0001192 gga-miR-128 UCACAGUGAACCGGUCUCUUU
ENSGALT00000040097 MI0001217 gga-miR-128 UCACAGUGAACCGGUCUCUUU
ENSGALT00000040097 MI0001200 gga-miR-216 UAAUCUCAGCUGGCAACUGUG
ENSGALT00000040097 MI0001208 gga-miR-223 UGUCAGUUUGUCAAAUACCCC
ENSGALT00000040097 MI0001274 gga-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSGALT00000040097 MI0001276 gga-miR-31 AGGCAAGAUGUUGGCAUAGCUG
ENSGALT00000040097 MI0003710 gga-miR-499 UUAAGACUUGUAGUGAUGUUUAG
ENSGALT00000040097 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENSGALT00000040097 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENSGALT00000040097 MI0002469 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC
ENSGALT00000040097 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSGALT00000040097 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENSGALT00000040097 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSGALT00000040097 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSGALT00000040097 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENSGALT00000040097 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSGALT00000040097 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENSGALT00000040097 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSGALT00000040097 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSGALT00000040097 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENSGALT00000040097 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENSGALT00000040097 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENSGALT00000040097 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_421638  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene