A1CF | GeneID:423680 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 423680 Official Symbol A1CF
Locus N/A Gene Type protein-coding
Synonyms
Full Name APOBEC1 complementation factor
Description APOBEC1 complementation factor
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16363

ID Symbol Protein Species
GeneID:29974 A1CF NP_620310.1 Homo sapiens
GeneID:69865 A1cf NP_001074543.1 Mus musculus
GeneID:170912 A1cf NP_596891.1 Rattus norvegicus
GeneID:423680 A1CF XP_421561.2 Gallus gallus
GeneID:466076 A1CF XP_001162517.1 Pan troglodytes
GeneID:477581 A1CF XP_534776.2 Canis lupus familiaris
GeneID:562916 a1cf XP_685178.1 Danio rerio
GeneID:613704 A1CF XP_869839.2 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_421561 XP_421561

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000005974 MI0005045 bta-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSGALT00000005974 MI0005021 bta-miR-380-5p UGGUUGACCAUAGAACAUGCGC
ENSGALT00000005974 MI0001277 gga-miR-122 UGGAGUGUGACAAUGGUGUUUGU
ENSGALT00000005974 MI0001280 gga-miR-122 UGGAGUGUGACAAUGGUGUUUGU
ENSGALT00000005974 MI0001241 gga-miR-130a CAGUGCAAUAUUAAAAGGGCAU
ENSGALT00000005974 MI0001239 gga-miR-130b CAGUGCAAUAAUGAAAGGGCGU
ENSGALT00000005974 MI0001249 gga-miR-200a UAACACUGUCUGGUAACGAUGU
ENSGALT00000005974 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSGALT00000005974 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENSGALT00000005974 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSGALT00000005974 MI0003583 hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC
ENSGALT00000005974 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENSGALT00000005974 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSGALT00000005974 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSGALT00000005974 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSGALT00000005974 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENSGALT00000005974 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENSGALT00000005974 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSGALT00000005974 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENSGALT00000005974 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSGALT00000005974 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSGALT00000005974 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSGALT00000005974 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSGALT00000005974 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSGALT00000005974 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_421561  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene