ABCD4 | GeneID:423349 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 423349 Official Symbol ABCD4
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family D (ALD), member 4
Description ATP-binding cassette, sub-family D (ALD), member 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3703

ID Symbol Protein Species
GeneID:5826 ABCD4 NP_005041.1 Homo sapiens
GeneID:19300 Abcd4 NP_033018.1 Mus musculus
GeneID:179968 pmp-3 NP_506620.1 Caenorhabditis elegans
GeneID:299196 Abcd4 XP_001061210.1 Rattus norvegicus
GeneID:423349 ABCD4 XP_421264.2 Gallus gallus
GeneID:453032 ABCD4 XP_001156286.1 Pan troglodytes
GeneID:490781 ABCD4 XP_547903.2 Canis lupus familiaris
GeneID:767748 zgc:153503 NP_001070185.1 Danio rerio
GeneID:841876 AT1G54350 NP_175837.2 Arabidopsis thaliana
GeneID:4324587 Os01g0218700 NP_001042413.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_421264 XP_421264

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000016629 MI0005058 bta-miR-150 UCUCCCAACCCUUGUACCAGUGU
ENSGALT00000016629 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSGALT00000016629 MI0005022 bta-miR-487a AAUCAUACAGGGACAUCCAGU
ENSGALT00000016629 MI0005060 bta-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSGALT00000016629 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSGALT00000016629 MI0001171 gga-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSGALT00000016629 MI0001234 gga-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSGALT00000016629 MI0001259 gga-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSGALT00000016629 MI0001172 gga-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSGALT00000016629 MI0001174 gga-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSGALT00000016629 MI0001232 gga-let-7d AGAGGUAGUGGGUUGCAUAGU
ENSGALT00000016629 MI0001233 gga-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSGALT00000016629 MI0001230 gga-let-7g UGAGGUAGUAGUUUGUACAGU
ENSGALT00000016629 MI0001168 gga-let-7i UGAGGUAGUAGUUUGUGCUGU
ENSGALT00000016629 MI0001263 gga-let-7k UGAGGUAGUAGAUUGAAUAGUU
ENSGALT00000016629 MI0001281 gga-miR-142-3p UGUAGUGUUUCCUACUUUAUGG
ENSGALT00000016629 MI0001190 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000016629 MI0001268 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000016629 MI0001282 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000016629 MI0003699 gga-miR-202* UUUCCUAUGCAUAUACUUCUUU
ENSGALT00000016629 MI0003709 gga-miR-490 CAACCUGGAGGACUCCAUGCUG
ENSGALT00000016629 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSGALT00000016629 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSGALT00000016629 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENSGALT00000016629 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSGALT00000016629 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENSGALT00000016629 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSGALT00000016629 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSGALT00000016629 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSGALT00000016629 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSGALT00000016629 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSGALT00000016629 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSGALT00000016629 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENSGALT00000016629 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSGALT00000016629 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENSGALT00000016629 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSGALT00000016629 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENSGALT00000016629 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSGALT00000016629 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSGALT00000016629 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSGALT00000016629 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENSGALT00000016629 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSGALT00000016629 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSGALT00000016629 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENSGALT00000016629 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC
ENSGALT00000016629 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_421264  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene