ABCC8 | GeneID:423072 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 423072 Official Symbol ABCC8
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68048

ID Symbol Protein Species
GeneID:6833 ABCC8 NP_000343.2 Homo sapiens
GeneID:20927 Abcc8 NP_035640.2 Mus musculus
GeneID:25559 Abcc8 NP_037171.1 Rattus norvegicus
GeneID:423072 ABCC8 XP_421005.2 Gallus gallus
GeneID:451056 ABCC8 XP_508310.2 Pan troglodytes
GeneID:485402 ABCC8 XP_542520.2 Canis lupus familiaris
GeneID:538996 ABCC8 XP_584132.3 Bos taurus
GeneID:553281 abcc8 XP_001920483.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0008281 Function sulfonylurea receptor activity
GO:0006813 Process potassium ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001232386 XP_001232387
2 XM_421005 XP_421005

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000009964 MI0005020 bta-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSGALT00000009964 MI0001190 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000009964 MI0001268 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000009964 MI0001282 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000009964 MI0001211 gga-miR-302a AAGUGCUUCCAUGUUUUAGUGA
ENSGALT00000009964 MI0003700 gga-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSGALT00000009964 MI0003701 gga-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENSGALT00000009964 MI0003702 gga-miR-302d UAAGUGCUUCCAUGUUUUAGUUG
ENSGALT00000009964 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSGALT00000009964 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSGALT00000009964 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSGALT00000009964 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSGALT00000009964 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSGALT00000009964 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSGALT00000009964 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENSGALT00000009964 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENSGALT00000009964 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSGALT00000009964 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene