ABLIM2 | GeneID:422866 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 422866 Official Symbol ABLIM2
Locus N/A Gene Type protein-coding
Synonyms
Full Name actin binding LIM protein family, member 2
Description actin binding LIM protein family, member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 82366

ID Symbol Protein Species
GeneID:231148 Ablim2 NP_808346.3 Mus musculus
GeneID:360958 Ablim2 NP_001001514.1 Rattus norvegicus
GeneID:422866 ABLIM2 XP_420811.2 Gallus gallus
GeneID:568454 LOC568454 XP_696875.3 Danio rerio
GeneID:610389 LOC610389 XP_852975.1 Canis lupus familiaris
GeneID:618227 LOC618227 XP_875649.2 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003779 Function actin binding
GO:0008270 Function zinc ion binding
GO:0007010 Process cytoskeleton organization

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_420811 XP_420811

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000025088 MI0001218 gga-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSGALT00000025088 MI0001178 gga-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENSGALT00000025088 MI0001211 gga-miR-302a AAGUGCUUCCAUGUUUUAGUGA
ENSGALT00000025088 MI0003700 gga-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSGALT00000025088 MI0003701 gga-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENSGALT00000025088 MI0003702 gga-miR-302d UAAGUGCUUCCAUGUUUUAGUUG
ENSGALT00000025088 MI0003694 gga-miR-9* UAAAGCUAGAGAACCGAAUGU
ENSGALT00000025088 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSGALT00000025088 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSGALT00000025088 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSGALT00000025088 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSGALT00000025088 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENSGALT00000025088 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSGALT00000025088 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSGALT00000025088 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSGALT00000025088 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENSGALT00000025088 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENSGALT00000025088 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSGALT00000025088 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_420811  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene