ABCE1 | GeneID:422462 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 422462 Official Symbol ABCE1
Locus N/A Gene Type protein-coding
Synonyms RLI
Full Name ATP-binding cassette, sub-family E (OABP), member 1
Description ATP-binding cassette, sub-family E (OABP), member 1
Chromosome N/A
Also Known As ATP-binding cassette, sub-family E, member 1; RNase L inhibitor
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2205

ID Symbol Protein Species
GeneID:6059 ABCE1 NP_001035809.1 Homo sapiens
GeneID:24015 Abce1 NP_056566.2 Mus musculus
GeneID:39027 CG5651 NP_648272.1 Drosophila melanogaster
GeneID:176733 abce-1 NP_499717.1 Caenorhabditis elegans
GeneID:361390 Abce1 XP_001064797.1 Rattus norvegicus
GeneID:406324 abce1 NP_998216.1 Danio rerio
GeneID:422462 ABCE1 NP_001006440.1 Gallus gallus
GeneID:461523 ABCE1 XP_517465.1 Pan troglodytes
GeneID:475454 ABCE1 XP_532679.2 Canis lupus familiaris
GeneID:514991 ABCE1 XP_592921.3 Bos taurus
GeneID:813912 MAL13P1.344 XP_001350392.1 Plasmodium falciparum
GeneID:827661 ATRLI2 NP_193656.2 Arabidopsis thaliana
GeneID:851665 RLI1 NP_010376.1 Saccharomyces cerevisiae
GeneID:1269374 AgaP_AGAP002182 XP_308004.2 Anopheles gambiae
GeneID:2539753 SPBC14F5.06 NP_596732.1 Schizosaccharomyces pombe
GeneID:2677986 MGG_11382 XP_362155.2 Magnaporthe grisea
GeneID:2712409 NCU03061.1 XP_330497.1 Neurospora crassa
GeneID:2891913 KLLA0C17556g XP_452984.1 Kluyveromyces lactis
GeneID:4350692 Os11g0546000 NP_001068062.1 Oryza sativa
GeneID:4623093 AGOS_AGR125W NP_986791.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab32270 ABCE1 antibody (ab32270); Rabbit polyclonal to ABCE1

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0009055 Function electron carrier activity
GO:0051536 Function iron-sulfur cluster binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001006440 NP_001006440

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000016194 MI0005022 bta-miR-487a AAUCAUACAGGGACAUCCAGU
ENSGALT00000016194 MI0003696 gga-miR-147 GUGUGCGGAAAUGCUUCUGC
ENSGALT00000016194 MI0003697 gga-miR-147 GUGUGCGGAAAUGCUUCUGC
ENSGALT00000016194 MI0001218 gga-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSGALT00000016194 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSGALT00000016194 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSGALT00000016194 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSGALT00000016194 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENSGALT00000016194 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSGALT00000016194 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSGALT00000016194 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENSGALT00000016194 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENSGALT00000038592 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSGALT00000038592 MI0005022 bta-miR-487a AAUCAUACAGGGACAUCCAGU
ENSGALT00000038592 MI0001281 gga-miR-142-3p UGUAGUGUUUCCUACUUUAUGG
ENSGALT00000038592 MI0003696 gga-miR-147 GUGUGCGGAAAUGCUUCUGC
ENSGALT00000038592 MI0003697 gga-miR-147 GUGUGCGGAAAUGCUUCUGC
ENSGALT00000038592 MI0001218 gga-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSGALT00000038592 MI0003708 gga-miR-489 AGUGACAUCAUAUGUACGGCUGC
ENSGALT00000038592 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSGALT00000038592 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENSGALT00000038592 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENSGALT00000038592 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSGALT00000038592 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098