ABCB10 | GeneID:421537 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 421537 Official Symbol ABCB10
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 10
Description ATP-binding cassette, sub-family B (MDR/TAP), member 10
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6474

ID Symbol Protein Species
GeneID:23456 ABCB10 NP_036221.1 Homo sapiens
GeneID:30994 CG3156 NP_569844.2 Drosophila melanogaster
GeneID:56199 Abcb10 NP_062425.1 Mus musculus
GeneID:178522 haf-1 NP_503098.2 Caenorhabditis elegans
GeneID:180056 haf-3 NP_506927.1 Caenorhabditis elegans
GeneID:361439 Abcb10 NP_001012166.1 Rattus norvegicus
GeneID:421537 ABCB10 XP_419578.2 Gallus gallus
GeneID:789800 ABCB10 XP_001256449.1 Bos taurus
GeneID:814343 MAL3P1.7 XP_001351101.1 Plasmodium falciparum
GeneID:833896 ATTAP2 NP_198720.2 Arabidopsis thaliana
GeneID:855858 MDL2 NP_015053.2 Saccharomyces cerevisiae
GeneID:1273250 AgaP_AGAP002717 XP_563428.1 Anopheles gambiae
GeneID:2541285 mdl1 NP_595751.1 Schizosaccharomyces pombe
GeneID:2685051 MGG_06878 XP_370381.2 Magnaporthe grisea
GeneID:2705539 NCU04117.1 XP_323457.1 Neurospora crassa
GeneID:2893314 KLLA0D00748g XP_453105.1 Kluyveromyces lactis
GeneID:4334151 Os03g0755100 NP_001051311.1 Oryza sativa
GeneID:4619550 AGOS_ACR022W NP_983425.1 Eremothecium gossypii
GeneID:100003744 LOC100003744 XP_001343218.2 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_419578 XP_419578

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000018079 MI0005009 bta-miR-139 UCUACAGUGCACGUGUCUCCAGU
ENSGALT00000018079 MI0005041 bta-miR-22-5p AGUUCUUCAGUGGCAAGCUUUA
ENSGALT00000018079 MI0005045 bta-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSGALT00000018079 MI0005047 bta-miR-425-5p AUGACACGAUCACUCCCGUUGA
ENSGALT00000018079 MI0001189 gga-miR-148a UCAGUGCACUACAGAACUUUGU
ENSGALT00000018079 MI0001249 gga-miR-200a UAACACUGUCUGGUAACGAUGU
ENSGALT00000018079 MI0001250 gga-miR-200b UAAUACUGCCUGGUAAUGAUGAU
ENSGALT00000018079 MI0001246 gga-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSGALT00000018079 MI0001204 gga-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
ENSGALT00000018079 MI0001205 gga-miR-30c UGUAAACAUCCUACACUCUCAGCU
ENSGALT00000018079 MI0001257 gga-miR-30c UGUAAACAUCCUACACUCUCAGCU
ENSGALT00000018079 MI0001256 gga-miR-30e UGUAAACAUCCUUGACUGG
ENSGALT00000018079 MI0001170 gga-miR-33 GUGCAUUGUAGUUGCAUUGC
ENSGALT00000018079 MI0006985 gga-miR-33 GUGCAUUGUAGUUGCAUUGC
ENSGALT00000018079 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSGALT00000018079 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENSGALT00000018079 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENSGALT00000018079 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSGALT00000018079 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENSGALT00000018079 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSGALT00000018079 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENSGALT00000018079 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSGALT00000018079 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSGALT00000018079 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSGALT00000018079 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSGALT00000018079 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSGALT00000018079 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSGALT00000018079 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSGALT00000018079 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSGALT00000018079 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSGALT00000018079 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSGALT00000018079 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSGALT00000018079 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSGALT00000018079 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSGALT00000018079 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSGALT00000018079 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSGALT00000018079 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSGALT00000018079 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSGALT00000018079 MI0005543 hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENSGALT00000018079 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENSGALT00000018079 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSGALT00000018079 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENSGALT00000018079 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENSGALT00000018079 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENSGALT00000018079 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSGALT00000018079 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSGALT00000018079 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSGALT00000018079 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENSGALT00000018079 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENSGALT00000018079 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_419578  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene