ABCG8 | GeneID:421402 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 421402 Official Symbol ABCG8
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)
Description ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23361

ID Symbol Protein Species
GeneID:64241 ABCG8 NP_071882.1 Homo sapiens
GeneID:67470 Abcg8 NP_080456.1 Mus musculus
GeneID:155192 Abcg8 NP_569098.2 Rattus norvegicus
GeneID:421402 ABCG8 XP_419458.2 Gallus gallus
GeneID:470363 ABCG8 XP_525745.2 Pan troglodytes
GeneID:474571 ABCG8 XP_531799.2 Canis lupus familiaris
GeneID:508829 ABCG8 NP_001019834.1 Bos taurus
GeneID:814660 AT2G01320 NP_178241.1 Arabidopsis thaliana
GeneID:854080 YOL075C NP_014567.1 Saccharomyces cerevisiae
GeneID:2682022 MGG_10410 XP_366191.1 Magnaporthe grisea
GeneID:2892176 KLLA0C04477g XP_452398.1 Kluyveromyces lactis
GeneID:4326045 Os01g0121700 NP_001041878.1 Oryza sativa
GeneID:100136850 abcg8 NP_001108041.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_419458 XP_419458

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000016186 MI0005019 bta-miR-345 GCUGACUCCUAGUCCAGUGCU
ENSGALT00000016186 MI0001270 gga-miR-101 GUACAGUACUGUGAUAACUGAA
ENSGALT00000016186 MI0007558 gga-miR-101 GUACAGUACUGUGAUAACUGAA
ENSGALT00000016186 MI0001176 gga-miR-155 UUAAUGCUAAUCGUGAUAGGGG
ENSGALT00000016186 MI0001190 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000016186 MI0001268 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000016186 MI0001282 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000016186 MI0001254 gga-miR-1b UGGAAUGUUAAGAAGUAUGUA
ENSGALT00000016186 MI0001207 gga-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSGALT00000016186 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENSGALT00000016186 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENSGALT00000016186 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSGALT00000016186 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSGALT00000016186 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSGALT00000016186 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSGALT00000016186 MI0003757 hsa-miR-758 UUUGUGACCUGGUCCACUAACC
ENSGALT00000016186 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSGALT00000016186 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSGALT00000016186 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENSGALT00000016186 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_419458  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene