ABCG5 | GeneID:421401 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 421401 Official Symbol ABCG5
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family G (WHITE), member 5 (sterolin 1)
Description ATP-binding cassette, sub-family G (WHITE), member 5 (sterolin 1)
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31909

ID Symbol Protein Species
GeneID:27409 Abcg5 NP_114090.1 Mus musculus
GeneID:42976 CG11069 NP_651307.2 Drosophila melanogaster
GeneID:64240 ABCG5 NP_071881.1 Homo sapiens
GeneID:114628 Abcg5 NP_446206.2 Rattus norvegicus
GeneID:421401 ABCG5 XP_419457.2 Gallus gallus
GeneID:481354 ABCG5 XP_538475.1 Canis lupus familiaris
GeneID:515536 ABCG5 NP_001019718.1 Bos taurus
GeneID:557317 LOC557317 XP_684646.1 Danio rerio
GeneID:1281061 AgaP_AGAP002051 XP_320996.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_419457 XP_419457

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000016182 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSGALT00000016182 MI0004996 gga-miR-144 CUACAGUAUAGAUGAUGUACUC
ENSGALT00000016182 MI0001188 gga-miR-153 UUGCAUAGUCACAAAAGUGA
ENSGALT00000016182 MI0001218 gga-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSGALT00000016182 MI0001243 gga-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSGALT00000016182 MI0001219 gga-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSGALT00000016182 MI0001242 gga-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSGALT00000016182 MI0001224 gga-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSGALT00000016182 MI0001250 gga-miR-200b UAAUACUGCCUGGUAAUGAUGAU
ENSGALT00000016182 MI0001166 gga-miR-29a UAGCACCAUUUGAAAUCGGUU
ENSGALT00000016182 MI0001167 gga-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSGALT00000016182 MI0001266 gga-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSGALT00000016182 MI0001265 gga-miR-29c UAGCACCAUUUGAAAUCGGU
ENSGALT00000016182 MI0001194 gga-miR-32 UAUUGCACAUUACUAAGUUGC
ENSGALT00000016182 MI0003714 gga-miR-429 UAAUACUGUCUGGUAAUGCCGU
ENSGALT00000016182 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSGALT00000016182 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSGALT00000016182 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENSGALT00000016182 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSGALT00000016182 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSGALT00000016182 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSGALT00000016182 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENSGALT00000016182 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSGALT00000016182 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENSGALT00000016182 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENSGALT00000016182 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSGALT00000016182 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENSGALT00000016182 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSGALT00000016182 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_419457  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene