ABHD12 | GeneID:421249 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 421249 Official Symbol ABHD12
Locus RCJMB04_24m17 Gene Type protein-coding
Synonyms
Full Name abhydrolase domain containing 12
Description abhydrolase domain containing 12
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22910

ID Symbol Protein Species
GeneID:26090 ABHD12 NP_001035937.1 Homo sapiens
GeneID:37200 CG15111 NP_611397.1 Drosophila melanogaster
GeneID:76192 Abhd12 NP_077785.1 Mus musculus
GeneID:179172 Y97E10AL.2 NP_505054.1 Caenorhabditis elegans
GeneID:421249 ABHD12 NP_001012889.1 Gallus gallus
GeneID:477004 ABHD12 XP_534202.2 Canis lupus familiaris
GeneID:499913 Abhd12 NP_001019485.1 Rattus norvegicus
GeneID:767657 abhd12 NP_001070065.1 Danio rerio
GeneID:768242 ABHD12 XP_001253369.1 Bos taurus
GeneID:1268858 ENSANGG00000010983 XP_307433.2 Anopheles gambiae
GeneID:1280498 ENSANGG00000011561 XP_320345.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0047372 Function acylglycerol lipase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001012871 NP_001012889

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000013893 MI0001241 gga-miR-130a CAGUGCAAUAUUAAAAGGGCAU
ENSGALT00000013893 MI0001239 gga-miR-130b CAGUGCAAUAAUGAAAGGGCGU
ENSGALT00000013893 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSGALT00000013893 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSGALT00000013893 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSGALT00000013893 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098