ABHD3 | GeneID:421068 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 421068 Official Symbol ABHD3
Locus N/A Gene Type protein-coding
Synonyms
Full Name abhydrolase domain containing 3
Description abhydrolase domain containing 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 14055

ID Symbol Protein Species
GeneID:35930 CG8058 NP_610459.2 Drosophila melanogaster
GeneID:106861 Abhd3 NP_598891.1 Mus musculus
GeneID:171586 ABHD3 NP_612213.2 Homo sapiens
GeneID:180309 Y60A3A.7 NP_507863.1 Caenorhabditis elegans
GeneID:180450 C44C1.5 NP_001024458.1 Caenorhabditis elegans
GeneID:291793 Abhd3 XP_214618.4 Rattus norvegicus
GeneID:421068 ABHD3 XP_419156.2 Gallus gallus
GeneID:447830 abhd3 NP_001004569.1 Danio rerio
GeneID:480177 ABHD3 XP_537301.2 Canis lupus familiaris
GeneID:539795 ABHD3 NP_001069655.1 Bos taurus
GeneID:824243 AT3G50790 NP_190648.1 Arabidopsis thaliana
GeneID:1270246 AgaP_AGAP006819 XP_308926.2 Anopheles gambiae
GeneID:4330156 Os02g0649400 NP_001047583.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0004091 Function carboxylesterase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_419156 XP_419156

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000024095 MI0001270 gga-miR-101 GUACAGUACUGUGAUAACUGAA
ENSGALT00000024095 MI0007558 gga-miR-101 GUACAGUACUGUGAUAACUGAA
ENSGALT00000024095 MI0001277 gga-miR-122 UGGAGUGUGACAAUGGUGUUUGU
ENSGALT00000024095 MI0001280 gga-miR-122 UGGAGUGUGACAAUGGUGUUUGU
ENSGALT00000024095 MI0001241 gga-miR-130a CAGUGCAAUAUUAAAAGGGCAU
ENSGALT00000024095 MI0001207 gga-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSGALT00000024095 MI0001199 gga-miR-30b UGUAAACAUCCUACACUCAGCU
ENSGALT00000024095 MI0001205 gga-miR-30c UGUAAACAUCCUACACUCUCAGCU
ENSGALT00000024095 MI0001257 gga-miR-30c UGUAAACAUCCUACACUCUCAGCU
ENSGALT00000024095 MI0000475 hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA
ENSGALT00000024095 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENSGALT00000024095 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSGALT00000024095 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSGALT00000024095 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSGALT00000024095 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSGALT00000024095 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSGALT00000024095 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENSGALT00000024095 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENSGALT00000024095 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSGALT00000024095 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSGALT00000024095 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENSGALT00000024095 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSGALT00000024095 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENSGALT00000024095 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSGALT00000024095 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSGALT00000024095 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSGALT00000024095 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_419156  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene