AARSD1 | GeneID:420013 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 420013 Official Symbol AARSD1
Locus N/A Gene Type protein-coding
Synonyms
Full Name alanyl-tRNA synthetase domain containing 1
Description alanyl-tRNA synthetase domain containing 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6821

ID Symbol Protein Species
GeneID:31318 CG10802 NP_570062.1 Drosophila melanogaster
GeneID:69684 Aarsd1 NP_659078.1 Mus musculus
GeneID:80755 AARSD1 NP_079543.1 Homo sapiens
GeneID:420013 AARSD1 XP_001235322.1 Gallus gallus
GeneID:445178 zgc:101066 NP_001003572.1 Danio rerio
GeneID:454704 AARSD1 XP_001157692.1 Pan troglodytes
GeneID:480510 AARSD1 XP_537630.2 Canis lupus familiaris
GeneID:510711 MGC134004 NP_001033162.1 Bos taurus
GeneID:619440 Aarsd1 NP_001029281.1 Rattus norvegicus
GeneID:855688 YNL040W NP_014358.1 Saccharomyces cerevisiae
GeneID:1272786 AgaP_AGAP003413 XP_311697.2 Anopheles gambiae
GeneID:2893329 KLLA0D02794g XP_453192.1 Kluyveromyces lactis

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005524 Function ATP binding
GO:0016876 Function ligase activity, forming aminoacyl-tRNA and related compounds
GO:0000166 Function nucleotide binding
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001235321 XP_001235322

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000004541 MI0004738 bta-miR-151 CUAGACUGAAGCUCCUUGAGG
ENSGALT00000004541 MI0005041 bta-miR-22-5p AGUUCUUCAGUGGCAAGCUUUA
ENSGALT00000004541 MI0001249 gga-miR-200a UAACACUGUCUGGUAACGAUGU
ENSGALT00000004541 MI0001250 gga-miR-200b UAAUACUGCCUGGUAAUGAUGAU
ENSGALT00000004541 MI0003699 gga-miR-202 AGAGGCAUAGAGCAUGGGAAAA
ENSGALT00000004541 MI0003701 gga-miR-302c* UUUAACAUGGAGGUACCUGCUG
ENSGALT00000004541 MI0000252 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENSGALT00000004541 MI0000473 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENSGALT00000004541 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSGALT00000004541 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENSGALT00000004541 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENSGALT00000004541 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENSGALT00000004541 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSGALT00000004541 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSGALT00000004541 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSGALT00000004541 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSGALT00000004541 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSGALT00000004541 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSGALT00000004541 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSGALT00000004541 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSGALT00000004541 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENSGALT00000004541 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSGALT00000004541 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSGALT00000004541 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSGALT00000004541 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSGALT00000004541 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSGALT00000004541 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENSGALT00000004541 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSGALT00000004541 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSGALT00000004541 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSGALT00000004541 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSGALT00000004541 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENSGALT00000004541 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSGALT00000004541 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSGALT00000004541 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENSGALT00000004541 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene