ABI3 | GeneID:419988 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 419988 Official Symbol ABI3
Locus N/A Gene Type protein-coding
Synonyms
Full Name ABI gene family, member 3
Description ABI gene family, member 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9505

ID Symbol Protein Species
GeneID:51225 ABI3 NP_057512.1 Homo sapiens
GeneID:66610 Abi3 NP_079935.1 Mus musculus
GeneID:303476 Abi3 NP_001013136.1 Rattus norvegicus
GeneID:419988 ABI3 XP_418110.1 Gallus gallus
GeneID:455199 ABI3 XP_511945.2 Pan troglodytes
GeneID:491068 ABI3 XP_548188.2 Canis lupus familiaris
GeneID:529835 ABI3 XP_608293.3 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_418110 XP_418110

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000001966 MI0005020 bta-miR-369-5p AUCGACCGUGUUAUAUUCGC
ENSGALT00000001966 MI0001175 gga-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSGALT00000001966 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENSGALT00000001966 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSGALT00000001966 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSGALT00000001966 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSGALT00000001966 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSGALT00000001966 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENSGALT00000001966 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENSGALT00000001966 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSGALT00000001966 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSGALT00000001966 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA
ENSGALT00000001966 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA
ENSGALT00000001966 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_418110  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene