AAK1 | GeneID:419512 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 419512 Official Symbol AAK1
Locus N/A Gene Type protein-coding
Synonyms
Full Name AP2 associated kinase 1
Description AP2 associated kinase 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 75032

ID Symbol Protein Species
GeneID:22848 AAK1 NP_055726.3 Homo sapiens
GeneID:269774 Aak1 NP_001035195.1 Mus musculus
GeneID:419512 AAK1 XP_417663.2 Gallus gallus
GeneID:474625 AAK1 XP_531855.2 Canis lupus familiaris
GeneID:500244 Aak1 XP_575594.2 Rattus norvegicus
GeneID:532546 AAK1 XP_611658.3 Bos taurus
GeneID:736127 AAK1 XP_001138098.1 Pan troglodytes
GeneID:817846 AT2G32850 NP_565756.1 Arabidopsis thaliana
GeneID:4346601 Os09g0279100 NP_001062756.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding
GO:0004674 Function protein serine/threonine kinase activity
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_417663 XP_417663

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000000026 MI0004749 bta-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSGALT00000000026 MI0001177 gga-miR-222 AGCUACAUCUGGCUACUGGGUCUC
ENSGALT00000000026 MI0000473 hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENSGALT00000000026 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSGALT00000000026 MI0005523 hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA
ENSGALT00000000026 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENSGALT00000000026 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSGALT00000000026 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENSGALT00000000026 MI0003189 hsa-miR-504 AGACCCUGGUCUGCACUCUAUC
ENSGALT00000000026 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENSGALT00000000026 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENSGALT00000000026 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENSGALT00000000026 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSGALT00000000026 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSGALT00000000026 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSGALT00000000026 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSGALT00000000026 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_417663  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene