AASDHPPT | GeneID:418975 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 418975 Official Symbol AASDHPPT
Locus N/A Gene Type protein-coding
Synonyms
Full Name aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Description aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9130

ID Symbol Protein Species
GeneID:60496 AASDHPPT NP_056238.2 Homo sapiens
GeneID:67618 Aasdhppt NP_080552.2 Mus musculus
GeneID:180425 T04G9.4 NP_508153.1 Caenorhabditis elegans
GeneID:189061 T28H10.1 NP_506135.1 Caenorhabditis elegans
GeneID:300328 Aasdhppt XP_217078.3 Rattus norvegicus
GeneID:317852 eap NP_729788.1 Drosophila melanogaster
GeneID:418975 AASDHPPT XP_417169.2 Gallus gallus
GeneID:451524 AASDHPPT XP_508734.2 Pan troglodytes
GeneID:489426 AASDHPPT XP_546544.2 Canis lupus familiaris
GeneID:519816 AASDHPPT XP_869172.1 Bos taurus
GeneID:619247 zgc:114148 NP_001028901.1 Danio rerio
GeneID:784811 AASDHPPT XP_001250766.1 Bos taurus
GeneID:4349713 Os11g0136500 NP_001065690.1 Oryza sativa
GeneID:4351429 Os12g0133400 NP_001066088.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0008897 Function holo-[acyl-carrier-protein] synthase activity
GO:0000287 Function magnesium ion binding
GO:0009059 Process macromolecule biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_417169 XP_417169

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000027741 MI0001197 gga-miR-124a UUAAGGCACGCGGUGAAUGCCA
ENSGALT00000027741 MI0008210 gga-miR-124a UUAAGGCACGCGGUGAAUGCCA
ENSGALT00000027741 MI0001250 gga-miR-200b UAAUACUGCCUGGUAAUGAUGAU
ENSGALT00000027741 MI0003699 gga-miR-202 AGAGGCAUAGAGCAUGGGAAAA
ENSGALT00000027741 MI0003699 gga-miR-202* UUUCCUAUGCAUAUACUUCUUU
ENSGALT00000027741 MI0003714 gga-miR-429 UAAUACUGUCUGGUAAUGCCGU
ENSGALT00000027741 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENSGALT00000027741 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSGALT00000027741 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSGALT00000027741 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSGALT00000027741 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSGALT00000027741 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSGALT00000027741 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSGALT00000027741 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA
ENSGALT00000027741 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSGALT00000027741 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_417169  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene