ABCC4 | GeneID:418791 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 418791 Official Symbol ABCC4
Locus RCJMB04_1m13 Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Chromosome N/A
Also Known As ATP-binding cassette, sub-family C, member 4
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74563

ID Symbol Protein Species
GeneID:10257 ABCC4 NP_005836.2 Homo sapiens
GeneID:35163 CG31792 NP_724148.1 Drosophila melanogaster
GeneID:47905 l(2)03659 NP_610482.2 Drosophila melanogaster
GeneID:170924 Abcc4 NP_596902.1 Rattus norvegicus
GeneID:180691 mrp-6 NP_508710.2 Caenorhabditis elegans
GeneID:239273 Abcc4 NP_001028508.1 Mus musculus
GeneID:368620 abcc4 NP_001007039.1 Danio rerio
GeneID:418791 ABCC4 NP_001025990.1 Gallus gallus
GeneID:452625 ABCC4 XP_001137006.1 Pan troglodytes
GeneID:485523 ABCC4 XP_542642.2 Canis lupus familiaris
GeneID:515333 ABCC4 XP_593336.2 Bos taurus
GeneID:820496 ATMRP3 NP_187915.1 Arabidopsis thaliana
GeneID:820497 ATMRP8 NP_187916.3 Arabidopsis thaliana
GeneID:820498 ATMRP7 NP_187917.3 Arabidopsis thaliana
GeneID:4327122 Os01g0173900 NP_001042159.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0005254 Function chloride channel activity
GO:0000166 Function nucleotide binding
GO:0006811 Process ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001030819 NP_001025990

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000027309 MI0005033 bta-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSGALT00000027309 MI0001239 gga-miR-130b CAGUGCAAUAAUGAAAGGGCGU
ENSGALT00000027309 MI0001235 gga-miR-146a UGAGAACUGAAUUCCAUGGGUU
ENSGALT00000027309 MI0001209 gga-miR-18b UAAGGUGCAUCUAGUGCAGUUA
ENSGALT00000027309 MI0001240 gga-miR-301 CAGUGCAAUAAUAUUGUCAAAGCAU
ENSGALT00000027309 MI0003712 gga-miR-367 AAUUGCACUUUAGCAAUGGUG
ENSGALT00000027309 MI0001179 gga-miR-92 UAUUGCACUUGUCCCGGCCUG
ENSGALT00000027309 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSGALT00000027309 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSGALT00000027309 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSGALT00000027309 MI0003185 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU
ENSGALT00000027309 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENSGALT00000027309 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSGALT00000027309 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSGALT00000027309 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSGALT00000027309 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSGALT00000027309 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSGALT00000027309 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSGALT00000027309 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSGALT00000027309 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENSGALT00000027309 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSGALT00000027309 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENSGALT00000027309 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENSGALT00000027309 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSGALT00000027309 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENSGALT00000027309 MI0003518 mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU
ENSGALT00000027309 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSGALT00000027309 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENSGALT00000027309 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSGALT00000027309 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSGALT00000027309 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSGALT00000027309 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098