A2LD1 | GeneID:418773 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 418773 Official Symbol A2LD1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description AIG2-like domain 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 15522

ID Symbol Protein Species
GeneID:37989 Tina-1 NP_611983.2 Drosophila melanogaster
GeneID:87769 A2LD1 XP_001714550.1 Homo sapiens
GeneID:223267 a2ld1 NP_663441.1 Mus musculus
GeneID:290500 A2ld1 NP_001020805.1 Rattus norvegicus
GeneID:418773 A2LD1 XP_416969.1 Gallus gallus
GeneID:447805 zgc:92115 NP_001004544.1 Danio rerio
GeneID:485534 A2LD1 XP_542653.2 Canis lupus familiaris
GeneID:777609 zgc:154024 NP_001071185.1 Danio rerio
GeneID:100038780 zgc:162208 NP_001083029.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001231824 XP_001231825
2 XM_416969 XP_416969

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000036535 MI0003696 gga-miR-147 GUGUGCGGAAAUGCUUCUGC
ENSGALT00000036535 MI0003697 gga-miR-147 GUGUGCGGAAAUGCUUCUGC
ENSGALT00000036535 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSGALT00000036535 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSGALT00000036535 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENSGALT00000036535 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSGALT00000036535 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSGALT00000036535 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSGALT00000036535 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENSGALT00000036535 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSGALT00000036535 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSGALT00000036535 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSGALT00000036535 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSGALT00000036535 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSGALT00000036535 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSGALT00000036535 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENSGALT00000036535 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene