ABHD13 | GeneID:418763 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 418763 Official Symbol ABHD13
Locus N/A Gene Type protein-coding
Synonyms
Full Name abhydrolase domain containing 13
Description abhydrolase domain containing 13
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6716

ID Symbol Protein Species
GeneID:44441 Bem46 NP_477372.1 Drosophila melanogaster
GeneID:68904 Abhd13 NP_001074588.1 Mus musculus
GeneID:84945 ABHD13 NP_116248.2 Homo sapiens
GeneID:306630 Abhd13 XP_225044.3 Rattus norvegicus
GeneID:418763 ABHD13 NP_001008681.1 Gallus gallus
GeneID:467322 ABHD13 XP_001135541.1 Pan troglodytes
GeneID:513848 ABHD13 XP_878914.1 Bos taurus
GeneID:561333 zgc:123286 NP_001032774.1 Danio rerio
GeneID:832174 WAV2 NP_568395.1 Arabidopsis thaliana
GeneID:855396 YNL320W NP_014079.1 Saccharomyces cerevisiae
GeneID:1275600 AgaP_AGAP008746 XP_314863.2 Anopheles gambiae
GeneID:2540264 bem46 NP_595609.1 Schizosaccharomyces pombe
GeneID:2675206 MGG_00142 XP_369102.2 Magnaporthe grisea
GeneID:2712588 NCU03276.1 XP_330712.1 Neurospora crassa
GeneID:2894644 KLLA0E21065g XP_454899.1 Kluyveromyces lactis
GeneID:4343867 Os07g0608300 NP_001060241.1 Oryza sativa
GeneID:4620051 AGOS_ADL187W NP_983909.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001008681 NP_001008681

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000027229 MI0005028 bta-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSGALT00000027229 MI0001216 gga-miR-10b UACCCUGUAGAACCGAAUUUGU
ENSGALT00000027229 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSGALT00000027229 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSGALT00000027229 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSGALT00000027229 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSGALT00000027229 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSGALT00000027229 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSGALT00000027229 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098