ABCG1 | GeneID:418533 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 418533 Official Symbol ABCG1
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family G (WHITE), member 1
Description ATP-binding cassette, sub-family G (WHITE), member 1
Chromosome N/A
Also Known As ATP-binding cassette sub-family G member 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21022

ID Symbol Protein Species
GeneID:9619 ABCG1 NP_004906.3 Homo sapiens
GeneID:11307 Abcg1 NP_033723.1 Mus musculus
GeneID:33636 Atet NP_001097078.1 Drosophila melanogaster
GeneID:85264 Abcg1 NP_445954.1 Rattus norvegicus
GeneID:178182 wht-5 NP_502352.1 Caenorhabditis elegans
GeneID:190068 wht-9 NP_499616.1 Caenorhabditis elegans
GeneID:418533 ABCG1 XP_416742.2 Gallus gallus
GeneID:458577 ABCG1 XP_514918.2 Pan troglodytes
GeneID:487777 ABCG1 XP_544902.2 Canis lupus familiaris
GeneID:510745 ABCG1 XP_587930.3 Bos taurus
GeneID:556979 zgc:162197 NP_001103924.1 Danio rerio
GeneID:840064 AT1G31770 NP_564383.1 Arabidopsis thaliana
GeneID:1281268 AgaP_AGAP001858 XP_550960.1 Anopheles gambiae
GeneID:4344750 Os08g0167000 NP_001061077.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_416742 XP_416742

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000026046 MI0005020 bta-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSGALT00000026046 MI0001244 gga-miR-126* CAUUAUUACUUUUGGUACGCG
ENSGALT00000026046 MI0001192 gga-miR-128 UCACAGUGAACCGGUCUCUUU
ENSGALT00000026046 MI0001217 gga-miR-128 UCACAGUGAACCGGUCUCUUU
ENSGALT00000026046 MI0003695 gga-miR-146b* CCCUAUGGAUUCAGUUCUGC
ENSGALT00000026046 MI0001249 gga-miR-200a UAACACUGUCUGGUAACGAUGU
ENSGALT00000026046 MI0003708 gga-miR-489 AGUGACAUCAUAUGUACGGCUGC
ENSGALT00000026046 MI0003694 gga-miR-9* UAAAGCUAGAGAACCGAAUGU
ENSGALT00000026046 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENSGALT00000026046 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSGALT00000026046 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSGALT00000026046 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSGALT00000026046 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENSGALT00000026046 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENSGALT00000026046 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSGALT00000026046 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSGALT00000026046 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENSGALT00000026046 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENSGALT00000026046 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene