ABHD10 | GeneID:418419 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 418419 Official Symbol ABHD10
Locus N/A Gene Type protein-coding
Synonyms
Full Name abhydrolase domain containing 10
Description abhydrolase domain containing 10
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10173

ID Symbol Protein Species
GeneID:55347 ABHD10 NP_060864.1 Homo sapiens
GeneID:213012 Abhd10 NP_766099.2 Mus musculus
GeneID:303953 Abhd10 XP_001064579.1 Rattus norvegicus
GeneID:418419 ABHD10 XP_416633.2 Gallus gallus
GeneID:478561 ABHD10 XP_535737.2 Canis lupus familiaris
GeneID:515563 ABHD10 NP_001015606.1 Bos taurus
GeneID:563031 LOC563031 XP_691488.2 Danio rerio
GeneID:568517 wu:fb10b08 XP_696942.2 Danio rerio
GeneID:743016 ABHD10 XP_001154093.1 Pan troglodytes

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_416633 XP_416633

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000024813 MI0005047 bta-miR-425-5p AUGACACGAUCACUCCCGUUGA
ENSGALT00000024813 MI0001244 gga-miR-126 UCGUACCGUGAGUAAUAAUGCGC
ENSGALT00000024813 MI0001221 gga-miR-137 UAUUGCUUAAGAAUACGCGUAG
ENSGALT00000024813 MI0001281 gga-miR-142-3p UGUAGUGUUUCCUACUUUAUGG
ENSGALT00000024813 MI0001188 gga-miR-153 UUGCAUAGUCACAAAAGUGA
ENSGALT00000024813 MI0001227 gga-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSGALT00000024813 MI0001260 gga-miR-34b CAGGCAGUGUAGUUAGCUGAUUG
ENSGALT00000024813 MI0003706 gga-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENSGALT00000024813 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENSGALT00000024813 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSGALT00000024813 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENSGALT00000024813 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENSGALT00000024813 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENSGALT00000024813 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENSGALT00000024813 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENSGALT00000024813 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENSGALT00000024813 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSGALT00000024813 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSGALT00000024813 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENSGALT00000024813 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENSGALT00000024813 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSGALT00000024813 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENSGALT00000024813 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_416633  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene