A4GALT | GeneID:418223 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 418223 Official Symbol A4GALT
Locus N/A Gene Type protein-coding
Synonyms
Full Name alpha 1,4-galactosyltransferase (globotriaosylceramide synthase)
Description alpha 1,4-galactosyltransferase (globotriaosylceramide synthase)
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9690

ID Symbol Protein Species
GeneID:33512 alpha4GT1 NP_608737.1 Drosophila melanogaster
GeneID:43124 alpha4GT2 NP_651434.2 Drosophila melanogaster
GeneID:53947 A4GALT NP_059132.1 Homo sapiens
GeneID:63888 A4galt NP_071576.1 Rattus norvegicus
GeneID:239559 A4galt NP_001004150.1 Mus musculus
GeneID:418223 A4GALT XP_416448.2 Gallus gallus
GeneID:470230 A4GALT NP_001009123.1 Pan troglodytes
GeneID:481222 A4GALT XP_538343.2 Canis lupus familiaris
GeneID:1277725 AgaP_AGAP008258 XP_317211.2 Anopheles gambiae
GeneID:3291688 AgaP_AGAP008260 XP_555205.1 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005795 Component Golgi stack
GO:0008378 Function galactosyltransferase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_416448 XP_416448

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000022862 MI0005045 bta-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSGALT00000022862 MI0004749 bta-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSGALT00000022862 MI0001220 gga-miR-199 CCCAGUGUUCAGACUACCUGUUC
ENSGALT00000022862 MI0001245 gga-miR-199 CCCAGUGUUCAGACUACCUGUUC
ENSGALT00000022862 MI0001250 gga-miR-200b UAAUACUGCCUGGUAAUGAUGAU
ENSGALT00000022862 MI0001203 gga-miR-215 AUGACCUAUGAAUUGACAGAC
ENSGALT00000022862 MI0001251 gga-miR-34a UGGCAGUGUCUUAGCUGGUUGUU
ENSGALT00000022862 MI0001260 gga-miR-34b CAGGCAGUGUAGUUAGCUGAUUG
ENSGALT00000022862 MI0001261 gga-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
ENSGALT00000022862 MI0003715 gga-miR-449 UGGCAGUGUAUGUUAGCUGGU
ENSGALT00000022862 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENSGALT00000022862 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSGALT00000022862 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENSGALT00000022862 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSGALT00000022862 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSGALT00000022862 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSGALT00000022862 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSGALT00000022862 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSGALT00000022862 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENSGALT00000022862 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSGALT00000022862 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSGALT00000022862 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSGALT00000022862 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENSGALT00000022862 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_416448  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene