ABCC9 | GeneID:418200 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 418200 Official Symbol ABCC9
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XR_027154

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000021626 MI0005033 bta-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSGALT00000021626 MI0005048 bta-miR-450 UUUUGCGAUGUGUUCCUAAUAU
ENSGALT00000021626 MI0005061 bta-miR-532 CAUGCCUUGAGUGUAGGACCGU
ENSGALT00000021626 MI0001169 gga-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSGALT00000021626 MI0001231 gga-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSGALT00000021626 MI0001264 gga-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSGALT00000021626 MI0001221 gga-miR-137 UAUUGCUUAAGAAUACGCGUAG
ENSGALT00000021626 MI0001170 gga-miR-33 GUGCAUUGUAGUUGCAUUGC
ENSGALT00000021626 MI0006985 gga-miR-33 GUGCAUUGUAGUUGCAUUGC
ENSGALT00000021626 MI0003708 gga-miR-489 AGUGACAUCAUAUGUACGGCUGC
ENSGALT00000021626 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENSGALT00000021626 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENSGALT00000021626 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSGALT00000021626 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSGALT00000021626 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSGALT00000021626 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSGALT00000021626 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSGALT00000021626 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSGALT00000021626 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENSGALT00000021626 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSGALT00000021626 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENSGALT00000021626 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSGALT00000021626 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSGALT00000021626 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENSGALT00000021626 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSGALT00000021626 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSGALT00000021626 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XR_027154  

Transcript Cluster

[ - ] NCBI's UniGene