AASS | GeneID:417757 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 417757 Official Symbol AASS
Locus N/A Gene Type protein-coding
Synonyms
Full Name aminoadipate-semialdehyde synthase
Description aminoadipate-semialdehyde synthase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4212

ID Symbol Protein Species
GeneID:10157 AASS NP_005754.2 Homo sapiens
GeneID:30956 Aass NP_038958.2 Mus musculus
GeneID:34064 CG7144 NP_609150.2 Drosophila melanogaster
GeneID:176842 dehydrogenase NP_499884.1 Caenorhabditis elegans
GeneID:296925 Aass XP_231524.4 Rattus norvegicus
GeneID:417757 AASS XP_416001.2 Gallus gallus
GeneID:472493 AASS XP_527868.2 Pan troglodytes
GeneID:482429 AASS XP_539546.2 Canis lupus familiaris
GeneID:520865 AASS XP_599115.3 Bos taurus
GeneID:556229 aass XP_684074.3 Danio rerio
GeneID:855786 LYS9 NP_014448.1 Saccharomyces cerevisiae
GeneID:1275481 AgaP_AGAP008632 XP_314728.2 Anopheles gambiae
GeneID:2540908 SPBC3B8.03 NP_596411.1 Schizosaccharomyces pombe
GeneID:2678741 MGG_08564 XP_362873.1 Magnaporthe grisea
GeneID:2704923 NCU03748.1 XP_323050.1 Neurospora crassa
GeneID:2892518 KLLA0C18744g XP_453035.1 Kluyveromyces lactis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_416001 XP_416001

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000014559 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENSGALT00000014559 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENSGALT00000014559 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENSGALT00000014559 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSGALT00000014559 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSGALT00000014559 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSGALT00000014559 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSGALT00000014559 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSGALT00000014559 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENSGALT00000014559 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSGALT00000014559 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSGALT00000014559 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENSGALT00000014559 MI0004664 mmu-miR-694 CUGAAAAUGUUGCCUGAAG
ENSGALT00000014559 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSGALT00000014559 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENSGALT00000014559 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_416001  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Manangi MK, et al. (2005) "Lysine alpha-ketoglutarate reductase and lysine oxidation are distributed in the extrahepatic tissues of chickens." J Nutr. 135(1):81-85. PMID:15623837