ABCD2 | GeneID:417694 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 417694 Official Symbol ABCD2
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family D (ALD), member 2
Description ATP-binding cassette, sub-family D (ALD), member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55873

ID Symbol Protein Species
GeneID:225 ABCD2 NP_005155.1 Homo sapiens
GeneID:26874 Abcd2 NP_036124.2 Mus musculus
GeneID:43772 CG2316 NP_726543.1 Drosophila melanogaster
GeneID:84356 Abcd2 NP_203503.1 Rattus norvegicus
GeneID:178527 pmp-4 NP_503105.1 Caenorhabditis elegans
GeneID:417694 ABCD2 XP_415938.2 Gallus gallus
GeneID:466952 ABCD2 XP_522352.2 Pan troglodytes
GeneID:477643 ABCD2 XP_534838.1 Canis lupus familiaris
GeneID:1281041 AgaP_AGAP002071 XP_320975.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_415938 XP_415938

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000011567 MI0005050 bta-miR-93 CAAAGUGCUGUUCGUGCAGGUA
ENSGALT00000011567 MI0001192 gga-miR-128 UCACAGUGAACCGGUCUCUUU
ENSGALT00000011567 MI0001217 gga-miR-128 UCACAGUGAACCGGUCUCUUU
ENSGALT00000011567 MI0001176 gga-miR-155 UUAAUGCUAAUCGUGAUAGGGG
ENSGALT00000011567 MI0001249 gga-miR-200a UAACACUGUCUGGUAACGAUGU
ENSGALT00000011567 MI0001214 gga-miR-203 GUGAAAUGUUUAGGACCACUUG
ENSGALT00000011567 MI0003700 gga-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSGALT00000011567 MI0003700 gga-miR-302b* ACUUUAACAUGGAGGUGCUUUCU
ENSGALT00000011567 MI0003701 gga-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENSGALT00000011567 MI0003701 gga-miR-302c* UUUAACAUGGAGGUACCUGCUG
ENSGALT00000011567 MI0003702 gga-miR-302d UAAGUGCUUCCAUGUUUUAGUUG
ENSGALT00000011567 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSGALT00000011567 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSGALT00000011567 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENSGALT00000011567 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSGALT00000011567 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSGALT00000011567 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENSGALT00000011567 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSGALT00000011567 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENSGALT00000011567 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENSGALT00000011567 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSGALT00000011567 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSGALT00000011567 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSGALT00000011567 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene