AATF | GeneID:417653 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 417653 Official Symbol AATF
Locus RCJMB04_24o4 Gene Type protein-coding
Synonyms
Full Name apoptosis antagonizing transcription factor
Description apoptosis antagonizing transcription factor
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 40811

ID Symbol Protein Species
GeneID:26574 AATF NP_036270.1 Homo sapiens
GeneID:33943 CG11188 NP_609066.1 Drosophila melanogaster
GeneID:56321 Aatf NP_062790.1 Mus musculus
GeneID:114512 Aatf NP_446172.1 Rattus norvegicus
GeneID:171723 Y73E7A.2 NP_490870.2 Caenorhabditis elegans
GeneID:417653 AATF NP_001025895.1 Gallus gallus
GeneID:454601 AATF XP_511427.2 Pan troglodytes
GeneID:480595 AATF XP_537715.2 Canis lupus familiaris
GeneID:559477 aatf NP_001077297.1 Danio rerio
GeneID:786013 AATF XP_001252958.1 Bos taurus
GeneID:836254 AT5G61330 NP_200941.2 Arabidopsis thaliana
GeneID:851893 BFR2 NP_010585.1 Saccharomyces cerevisiae
GeneID:1269788 AgaP_AGAP007394 XP_308438.2 Anopheles gambiae
GeneID:2543540 SPAC664.08c NP_593456.1 Schizosaccharomyces pombe
GeneID:2677840 MGG_04641 XP_362196.2 Magnaporthe grisea
GeneID:2706053 NCU04787.1 XP_324144.1 Neurospora crassa
GeneID:2892016 KLLA0C10362g XP_452661.1 Kluyveromyces lactis
GeneID:4323936 Os01g0526200 NP_001043227.1 Oryza sativa
GeneID:4618523 AGOS_AAL064W NP_982478.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005730 Component nucleolus
GO:0005634 Component nucleus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001030724 NP_001025895

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000008707 MI0003713 gga-miR-466 AUAUAUACACACACACAUAAGAC
ENSGALT00000008707 MI0003126 hsa-miR-491-3p CUUAUGCAAGAUUCCCUUCUAC
ENSGALT00000008707 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSGALT00000008707 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSGALT00000008707 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSGALT00000008707 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSGALT00000008707 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSGALT00000008707 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSGALT00000008707 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSGALT00000008707 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSGALT00000008707 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSGALT00000008707 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSGALT00000008707 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENSGALT00000008707 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSGALT00000008707 MI0001526 mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098