ABHD11 | GeneID:417473 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 417473 Official Symbol ABHD11
Locus N/A Gene Type protein-coding
Synonyms
Full Name abhydrolase domain containing 11
Description abhydrolase domain containing 11
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5961

ID Symbol Protein Species
GeneID:31663 CG2059 NP_572388.1 Drosophila melanogaster
GeneID:68758 Abhd11 NP_660250.1 Mus musculus
GeneID:83451 ABHD11 NP_683710.1 Homo sapiens
GeneID:173096 R05D7.4 NP_493077.1 Caenorhabditis elegans
GeneID:185192 F32B4.6 NP_492942.1 Caenorhabditis elegans
GeneID:360831 Abhd11 XP_341105.1 Rattus norvegicus
GeneID:417473 ABHD11 XP_415721.2 Gallus gallus
GeneID:446169 abhd11 NP_001004290.1 Danio rerio
GeneID:472412 ABHD11 XP_001147903.1 Pan troglodytes
GeneID:489803 ABHD11 XP_546921.1 Canis lupus familiaris
GeneID:510109 ABHD11 NP_001029544.1 Bos taurus
GeneID:686139 LOC686139 XP_001066660.1 Rattus norvegicus
GeneID:810986 PF11_0441 XP_001348110.1 Plasmodium falciparum
GeneID:852919 YGR031W NP_011545.1 Saccharomyces cerevisiae
GeneID:1280255 AgaP_AGAP009289 XP_320086.1 Anopheles gambiae
GeneID:2541745 SPAC22H12.03 NP_593115.1 Schizosaccharomyces pombe
GeneID:2685094 MGG_06921 XP_370424.2 Magnaporthe grisea
GeneID:2709957 NCU01454.1 XP_327893.1 Neurospora crassa
GeneID:2897458 KLLA0B05863g XP_451797.1 Kluyveromyces lactis
GeneID:4619344 AGOS_ACL180C NP_983224.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_415721 XP_415721

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000001583 MI0005463 bta-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSGALT00000001583 MI0001184 gga-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
ENSGALT00000001583 MI0001517 gga-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENSGALT00000001583 MI0001211 gga-miR-302a AAGUGCUUCCAUGUUUUAGUGA
ENSGALT00000001583 MI0003700 gga-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSGALT00000001583 MI0003701 gga-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENSGALT00000001583 MI0003702 gga-miR-302d UAAGUGCUUCCAUGUUUUAGUUG
ENSGALT00000001583 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSGALT00000001583 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSGALT00000001583 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSGALT00000001583 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENSGALT00000001583 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENSGALT00000001583 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSGALT00000001583 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSGALT00000001583 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSGALT00000001583 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENSGALT00000001583 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENSGALT00000001583 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSGALT00000001583 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSGALT00000001583 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSGALT00000001583 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSGALT00000001583 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSGALT00000001583 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSGALT00000001583 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSGALT00000001583 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSGALT00000001583 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSGALT00000001583 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSGALT00000001583 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENSGALT00000001583 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENSGALT00000001583 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENSGALT00000001583 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSGALT00000001583 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSGALT00000001583 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENSGALT00000001583 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSGALT00000001583 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSGALT00000001583 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSGALT00000001583 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENSGALT00000001583 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSGALT00000001583 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENSGALT00000001583 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSGALT00000001583 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENSGALT00000001583 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSGALT00000001583 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSGALT00000001583 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSGALT00000001583 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSGALT00000001583 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSGALT00000001583 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSGALT00000001583 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSGALT00000001583 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSGALT00000001583 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSGALT00000001583 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENSGALT00000001583 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSGALT00000001583 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENSGALT00000001583 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_415721  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene