ABCA5 | GeneID:417444 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 417444 Official Symbol ABCA5
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family A (ABC1), member 5
Description ATP-binding cassette, sub-family A (ABC1), member 5
Chromosome N/A
Also Known As ATP-binding cassette, sub-family A , member 5
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10263

ID Symbol Protein Species
GeneID:23461 ABCA5 NP_061142.2 Homo sapiens
GeneID:217265 Abca5 NP_671752.1 Mus musculus
GeneID:286970 Abca5 NP_775429.1 Rattus norvegicus
GeneID:417444 ABCA5 XP_415695.2 Gallus gallus
GeneID:454848 ABCA5 XP_001166542.1 Pan troglodytes
GeneID:480455 ABCA5 XP_537573.2 Canis lupus familiaris
GeneID:510497 ABCA5 XP_587636.3 Bos taurus
GeneID:1272631 AgaP_AGAP010416 XP_311531.2 Anopheles gambiae
GeneID:100151075 LOC100151075 XP_001918691.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_415695 XP_415695

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000006907 MI0005467 bta-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSGALT00000006907 MI0001189 gga-miR-148a UCAGUGCACUACAGAACUUUGU
ENSGALT00000006907 MI0001186 gga-miR-15a UAGCAGCACAUAAUGGUUUGU
ENSGALT00000006907 MI0001223 gga-miR-15b UAGCAGCACAUCAUGGUUUGCA
ENSGALT00000006907 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSGALT00000006907 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENSGALT00000006907 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENSGALT00000006907 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSGALT00000006907 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENSGALT00000006907 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSGALT00000006907 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSGALT00000006907 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSGALT00000006907 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENSGALT00000006907 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSGALT00000006907 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSGALT00000006907 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSGALT00000006907 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSGALT00000006907 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSGALT00000006907 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSGALT00000006907 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSGALT00000006907 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSGALT00000006907 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSGALT00000006907 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSGALT00000006907 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENSGALT00000006907 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene