ABL1 | GeneID:417181 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 417181 Official Symbol ABL1
Locus N/A Gene Type protein-coding
Synonyms ABL
Full Name v-abl Abelson murine leukemia viral oncogene homolog 1
Description v-abl Abelson murine leukemia viral oncogene homolog 1
Chromosome N/A
Also Known As c-abl oncogene 1, receptor tyrosine kinase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3783

ID Symbol Protein Species
GeneID:25 ABL1 NP_009297.2 Homo sapiens
GeneID:11350 Abl1 NP_033724.1 Mus musculus
GeneID:311860 Abl1 XP_001067860.1 Rattus norvegicus
GeneID:417181 ABL1 XP_001233812.1 Gallus gallus
GeneID:464802 ABL1 XP_001166213.1 Pan troglodytes
GeneID:491292 ABL1 XP_548413.2 Canis lupus familiaris
GeneID:540876 ABL1 XP_613548.2 Bos taurus
GeneID:100000720 LOC100000720 XP_001337829.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding
GO:0004713 Function protein tyrosine kinase activity
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001233811 XP_001233812
2 XM_415463 XP_415463

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000006164 MI0005028 bta-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSGALT00000006164 MI0005058 bta-miR-150 UCUCCCAACCCUUGUACCAGUGU
ENSGALT00000006164 MI0005046 bta-miR-423 AAGCUCGGUCUGAGGCCCCUCAGU
ENSGALT00000006164 MI0005050 bta-miR-93 CAAAGUGCUGUUCGUGCAGGUA
ENSGALT00000006164 MI0001210 gga-miR-106 AAAAGUGCUUACAGUGCAGGUA
ENSGALT00000006164 MI0001229 gga-miR-140* CCACAGGGUAGAACCACGGAC
ENSGALT00000006164 MI0001181 gga-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSGALT00000006164 MI0001517 gga-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENSGALT00000006164 MI0001256 gga-miR-30e UGUAAACAUCCUUGACUGG
ENSGALT00000006164 MI0003708 gga-miR-489 AGUGACAUCAUAUGUACGGCUGC
ENSGALT00000006164 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENSGALT00000006164 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSGALT00000006164 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSGALT00000006164 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSGALT00000006164 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSGALT00000006164 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSGALT00000006164 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSGALT00000006164 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSGALT00000006164 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSGALT00000006164 MI0003628 hsa-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENSGALT00000006164 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSGALT00000006164 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSGALT00000006164 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSGALT00000006164 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSGALT00000006164 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSGALT00000006164 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENSGALT00000006164 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Rhee J, et al. (2007) "Cables links Robo-bound Abl kinase to N-cadherin-bound beta-catenin to mediate Slit-induced modulation of adhesion and transcription." Nat Cell Biol. 9(8):883-892. PMID:17618275