ABCB9 | GeneID:416834 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 416834 Official Symbol ABCB9
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 9
Description ATP-binding cassette, sub-family B (MDR/TAP), member 9
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10491

ID Symbol Protein Species
GeneID:23457 ABCB9 NP_982269.1 Homo sapiens
GeneID:56325 Abcb9 NP_063928.2 Mus musculus
GeneID:63886 Abcb9 NP_071574.1 Rattus norvegicus
GeneID:416834 ABCB9 XP_415125.2 Gallus gallus
GeneID:452335 ABCB9 XP_509453.2 Pan troglodytes
GeneID:477456 ABCB9 XP_849373.1 Canis lupus familiaris
GeneID:570148 DKEY-21K4.3 XP_698681.3 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_415125 XP_415125

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000005928 MI0004756 bta-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSGALT00000005928 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSGALT00000005928 MI0001219 gga-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSGALT00000005928 MI0001242 gga-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSGALT00000005928 MI0001193 gga-miR-187 UCGUGUCUUGUGUUGCAGCC
ENSGALT00000005928 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSGALT00000005928 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSGALT00000005928 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSGALT00000005928 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSGALT00000005928 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSGALT00000005928 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSGALT00000005928 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENSGALT00000005928 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSGALT00000005928 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSGALT00000005928 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSGALT00000005928 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSGALT00000005928 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSGALT00000005928 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSGALT00000005928 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSGALT00000005928 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENSGALT00000005928 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSGALT00000005928 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENSGALT00000005928 MI0003518 mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU
ENSGALT00000005928 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSGALT00000005928 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSGALT00000005928 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSGALT00000005928 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSGALT00000005928 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSGALT00000005928 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENSGALT00000005928 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSGALT00000005928 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENSGALT00000005928 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_415125  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene