AACS | GeneID:416811 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 416811 Official Symbol AACS
Locus N/A Gene Type protein-coding
Synonyms
Full Name acetoacetyl-CoA synthetase
Description acetoacetyl-CoA synthetase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11322

ID Symbol Protein Species
GeneID:65984 Aacs NP_075592.1 Rattus norvegicus
GeneID:65985 AACS NP_076417.2 Homo sapiens
GeneID:78894 Aacs NP_084486.1 Mus musculus
GeneID:180992 sur-5 NP_509229.1 Caenorhabditis elegans
GeneID:393984 aacs NP_957303.1 Danio rerio
GeneID:416811 AACS NP_001006184.1 Gallus gallus
GeneID:452361 AACS XP_001135709.1 Pan troglodytes
GeneID:486240 AACS XP_543365.2 Canis lupus familiaris
GeneID:505842 AACS XP_582199.3 Bos taurus
GeneID:2675470 MGG_05196 XP_359581.2 Magnaporthe grisea
GeneID:2704372 NCU00446.1 XP_322532.1 Neurospora crassa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0030729 Function acetoacetate-CoA ligase activity
GO:0005524 Function ATP binding
GO:0003824 Function catalytic activity
GO:0016874 Function ligase activity
GO:0000166 Function nucleotide binding
GO:0006631 Process fatty acid metabolic process
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001006184 NP_001006184

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000004577 MI0001187 gga-miR-26a UUCAAGUAAUCCAGGAUAGGC
ENSGALT00000004577 MI0001211 gga-miR-302a AAGUGCUUCCAUGUUUUAGUGA
ENSGALT00000004577 MI0003713 gga-miR-466 AUAUAUACACACACACAUAAGAC
ENSGALT00000004577 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSGALT00000004577 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSGALT00000004577 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENSGALT00000004577 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSGALT00000004577 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSGALT00000004577 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSGALT00000004577 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSGALT00000004577 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSGALT00000004577 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098