A2BP1 | GeneID:416645 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 416645 Official Symbol A2BP1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ataxin 2-binding protein 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69339

ID Symbol Protein Species
GeneID:54715 A2BP1 NP_665898.1 Homo sapiens
GeneID:268859 A2bp1 NP_899011.1 Mus musculus
GeneID:302920 A2bp1 XP_220155.3 Rattus norvegicus
GeneID:416645 A2BP1 XP_414942.2 Gallus gallus
GeneID:449554 a2bp1 NP_001005596.1 Danio rerio
GeneID:609116 LOC609116 XP_851461.1 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_414942 XP_414942

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000011913 MI0005020 bta-miR-369-5p AUCGACCGUGUUAUAUUCGC
ENSGALT00000011913 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSGALT00000011913 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSGALT00000011913 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSGALT00000011913 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSGALT00000011913 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENSGALT00000011913 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENSGALT00000011913 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENSGALT00000011913 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSGALT00000011913 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSGALT00000011913 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSGALT00000011913 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENSGALT00000011913 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSGALT00000011913 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENSGALT00000011913 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENSGALT00000011913 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENSGALT00000011913 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSGALT00000011913 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene