ABCA3 | GeneID:416386 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 416386 Official Symbol ABCA3
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family A (ABC1), member 3
Description ATP-binding cassette, sub-family A (ABC1), member 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37437

ID Symbol Protein Species
GeneID:21 ABCA3 NP_001080.2 Homo sapiens
GeneID:27410 Abca3 NP_001034670.1 Mus musculus
GeneID:33103 CG1718 NP_608445.1 Drosophila melanogaster
GeneID:178559 abt-4 NP_503175.1 Caenorhabditis elegans
GeneID:302973 Abca3 XP_220219.4 Rattus norvegicus
GeneID:416386 ABCA3 XP_414701.2 Gallus gallus
GeneID:453833 ABCA3 XP_510744.2 Pan troglodytes
GeneID:479879 ABCA3 XP_537004.2 Canis lupus familiaris
GeneID:505787 ABCA3 XP_582132.3 Bos taurus
GeneID:1269722 AgaP_AGAP007504 XP_308371.2 Anopheles gambiae
GeneID:1276992 AgaP_AGAP006379 XP_557048.1 Anopheles gambiae
GeneID:1280527 AgaP_AGAP012156 XP_552044.1 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_414701 XP_414701

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000003054 MI0005039 bta-miR-210 ACUGUGCGUGUGACAGCGGCUGA
ENSGALT00000003054 MI0001197 gga-miR-124a UUAAGGCACGCGGUGAAUGCCA
ENSGALT00000003054 MI0008210 gga-miR-124a UUAAGGCACGCGGUGAAUGCCA
ENSGALT00000003054 MI0001252 gga-miR-124b UUAAGGCACGCAGUGAAUGCCA
ENSGALT00000003054 MI0001253 gga-miR-124b UUAAGGCACGCAGUGAAUGCCA
ENSGALT00000003054 MI0003713 gga-miR-466 AUAUAUACACACACACAUAAGAC
ENSGALT00000003054 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSGALT00000003054 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSGALT00000003054 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENSGALT00000003054 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSGALT00000003054 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSGALT00000003054 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSGALT00000003054 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSGALT00000003054 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSGALT00000003054 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENSGALT00000003054 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENSGALT00000003054 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSGALT00000003054 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSGALT00000003054 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSGALT00000003054 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSGALT00000003054 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENSGALT00000003054 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSGALT00000003054 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENSGALT00000003054 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSGALT00000003054 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSGALT00000003054 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENSGALT00000003054 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSGALT00000003054 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSGALT00000003054 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSGALT00000003054 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSGALT00000003054 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSGALT00000003054 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSGALT00000003054 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSGALT00000003054 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSGALT00000003054 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENSGALT00000003054 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENSGALT00000003054 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSGALT00000003054 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSGALT00000003054 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENSGALT00000003054 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA
ENSGALT00000003054 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_414701  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene