ABTB1 | GeneID:416026 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 416026 Official Symbol ABTB1
Locus RCJMB04_9f7 Gene Type protein-coding
Synonyms
Full Name ankyrin repeat and BTB (POZ) domain containing 1
Description ankyrin repeat and BTB (POZ) domain containing 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 32731

ID Symbol Protein Species
GeneID:80283 Abtb1 NP_084527.1 Mus musculus
GeneID:80325 ABTB1 NP_742024.1 Homo sapiens
GeneID:297432 Abtb1 NP_001005902.1 Rattus norvegicus
GeneID:416026 ABTB1 NP_001025769.1 Gallus gallus
GeneID:507417 ABTB1 XP_584015.2 Bos taurus
GeneID:609299 ABTB1 XP_851631.1 Canis lupus familiaris
GeneID:796990 LOC796990 XP_001337407.2 Danio rerio
GeneID:815017 AT2G04740 NP_178551.2 Arabidopsis thaliana
GeneID:854816 YIL001W NP_012265.1 Saccharomyces cerevisiae
GeneID:2542872 btb3 NP_593682.1 Schizosaccharomyces pombe
GeneID:2682580 MGG_03027 XP_366951.2 Magnaporthe grisea
GeneID:2712632 NCU03186.1 XP_330622.1 Neurospora crassa
GeneID:2892719 KLLA0D13838g XP_453679.1 Kluyveromyces lactis
GeneID:4340880 Os06g0318200 NP_001057501.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005515 Function protein binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001030598 NP_001025769

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000009651 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSGALT00000009651 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSGALT00000009651 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098