ABHD6 | GeneID:416009 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 416009 Official Symbol ABHD6
Locus N/A Gene Type protein-coding
Synonyms
Full Name abhydrolase domain containing 6
Description abhydrolase domain containing 6
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23246

ID Symbol Protein Species
GeneID:57406 ABHD6 NP_065727.3 Homo sapiens
GeneID:66082 Abhd6 NP_079617.2 Mus musculus
GeneID:305795 Abhd6 NP_001007681.1 Rattus norvegicus
GeneID:416009 ABHD6 XP_414352.1 Gallus gallus
GeneID:470830 ABHD6 XP_526213.2 Pan troglodytes
GeneID:484712 ABHD6 XP_541828.1 Canis lupus familiaris
GeneID:505283 ABHD6 NP_001068664.1 Bos taurus
GeneID:799085 LOC799085 XP_001339480.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_414352 XP_414352

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000009138 MI0005008 bta-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSGALT00000009138 MI0005035 bta-miR-192 CUGACCUAUGAAUUGACAGCCAG
ENSGALT00000009138 MI0001175 gga-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSGALT00000009138 MI0003695 gga-miR-146b UGAGAACUGAAUUCCAUAGGCG
ENSGALT00000009138 MI0001182 gga-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSGALT00000009138 MI0001180 gga-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSGALT00000009138 MI0001203 gga-miR-215 AUGACCUAUGAAUUGACAGAC
ENSGALT00000009138 MI0001211 gga-miR-302a AAGUGCUUCCAUGUUUUAGUGA
ENSGALT00000009138 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSGALT00000009138 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENSGALT00000009138 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSGALT00000009138 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENSGALT00000009138 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENSGALT00000009138 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSGALT00000009138 MI0005759 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC
ENSGALT00000009138 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSGALT00000009138 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENSGALT00000009138 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSGALT00000009138 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene