AARS | GeneID:415668 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 415668 Official Symbol AARS
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alanyl-tRNA synthetase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1213

ID Symbol Protein Species
GeneID:16 AARS NP_001596.2 Homo sapiens
GeneID:34156 Aats-ala NP_523511.2 Drosophila melanogaster
GeneID:171985 ars-2 NP_491281.1 Caenorhabditis elegans
GeneID:234734 Aars NP_666329.2 Mus musculus
GeneID:292023 Aars XP_214690.3 Rattus norvegicus
GeneID:324940 aars NP_001037775.1 Danio rerio
GeneID:415668 AARS NP_001005836.1 Gallus gallus
GeneID:454210 AARS XP_001169474.1 Pan troglodytes
GeneID:479656 AARS XP_536788.2 Canis lupus familiaris
GeneID:510933 AARS XP_588170.3 Bos taurus
GeneID:814313 PF13_0354 XP_001350388.1 Plasmodium falciparum
GeneID:841442 ALATS NP_175439.2 Arabidopsis thaliana
GeneID:854513 ALA1 NP_014980.1 Saccharomyces cerevisiae
GeneID:1279087 AgaP_AGAP009701 XP_318757.2 Anopheles gambiae
GeneID:2542031 SPAC23C11.09 NP_593640.1 Schizosaccharomyces pombe
GeneID:2676649 MGG_03607 XP_361064.2 Magnaporthe grisea
GeneID:2713811 NCU02566.1 XP_331765.1 Neurospora crassa
GeneID:2894909 KLLA0F02431g XP_455190.1 Kluyveromyces lactis
GeneID:4348211 Os10g0182000 NP_001064254.1 Oryza sativa
GeneID:4620624 AGOS_ADR363C NP_984459.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0004813 Function alanine-tRNA ligase activity
GO:0005524 Function ATP binding
GO:0016876 Function ligase activity, forming aminoacyl-tRNA and related compounds
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0006419 Process alanyl-tRNA aminoacylation
GO:0021680 Process cerebellar Purkinje cell layer development
GO:0030968 Process endoplasmic reticulum unfolded protein response
GO:0001942 Process hair follicle development
GO:0043524 Process negative regulation of neuron apoptosis
GO:0050885 Process neuromuscular process controlling balance
GO:0006457 Process protein folding
GO:0043200 Process response to amino acid stimulus
GO:0043588 Process skin development
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation
GO:0006400 Process tRNA modification

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001005836 NP_001005836

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000003047 MI0005463 bta-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSGALT00000003047 MI0005468 bta-miR-660 UACCCAUUGCAUAUCGGAGCUG
ENSGALT00000003047 MI0001193 gga-miR-187 UCGUGUCUUGUGUUGCAGCC
ENSGALT00000003047 MI0001183 gga-miR-18a UAAGGUGCAUCUAGUGCAGAUA
ENSGALT00000003047 MI0001209 gga-miR-18b UAAGGUGCAUCUAGUGCAGUUA
ENSGALT00000003047 MI0001190 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000003047 MI0001268 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000003047 MI0001282 gga-miR-196 UAGGUAGUUUCAUGUUGUUGG
ENSGALT00000003047 MI0001208 gga-miR-223 UGUCAGUUUGUCAAAUACCCC
ENSGALT00000003047 MI0003705 gga-miR-375 UUUGUUCGUUCGGCUCGCGUUA
ENSGALT00000003047 MI0003709 gga-miR-490 CAACCUGGAGGACUCCAUGCUG
ENSGALT00000003047 MI0000252 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENSGALT00000003047 MI0000473 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENSGALT00000003047 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSGALT00000003047 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENSGALT00000003047 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSGALT00000003047 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSGALT00000003047 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSGALT00000003047 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSGALT00000003047 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSGALT00000003047 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSGALT00000003047 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSGALT00000003047 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSGALT00000003047 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENSGALT00000003047 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENSGALT00000003047 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENSGALT00000003047 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSGALT00000003047 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENSGALT00000003047 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSGALT00000003047 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSGALT00000003047 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098