ABHD2 | GeneID:415493 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 415493 Official Symbol ABHD2
Locus N/A Gene Type protein-coding
Synonyms
Full Name abhydrolase domain containing 2
Description abhydrolase domain containing 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23121

ID Symbol Protein Species
GeneID:11057 ABHD2 NP_008942.3 Homo sapiens
GeneID:33532 CG3488 NP_608751.2 Drosophila melanogaster
GeneID:54608 Abhd2 NP_061281.3 Mus musculus
GeneID:293050 Abhd2 XP_214979.2 Rattus norvegicus
GeneID:393888 abhd2a NP_957208.1 Danio rerio
GeneID:415493 ABHD2 XP_413866.2 Gallus gallus
GeneID:467753 ABHD2 XP_523148.2 Pan troglodytes
GeneID:479037 ABHD2 XP_849732.1 Canis lupus familiaris
GeneID:508717 ABHD2 NP_001015549.1 Bos taurus
GeneID:559290 abhd2b NP_001073145.1 Danio rerio
GeneID:1277482 ENSANGG00000004955 XP_316894.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0004091 Function carboxylesterase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_413866 XP_413866

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000010812 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSGALT00000010812 MI0001171 gga-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSGALT00000010812 MI0001234 gga-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSGALT00000010812 MI0001259 gga-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSGALT00000010812 MI0001172 gga-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSGALT00000010812 MI0001174 gga-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSGALT00000010812 MI0001185 gga-miR-16 UAGCAGCACGUAAAUAUUGGUG
ENSGALT00000010812 MI0001222 gga-miR-16 UAGCAGCACGUAAAUAUUGGUG
ENSGALT00000010812 MI0003709 gga-miR-490 CAACCUGGAGGACUCCAUGCUG
ENSGALT00000010812 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENSGALT00000010812 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSGALT00000010812 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSGALT00000010812 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSGALT00000010812 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSGALT00000010812 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSGALT00000010812 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENSGALT00000010812 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSGALT00000010812 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENSGALT00000010812 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSGALT00000010812 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_413866  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene