ACCN2 | GeneID:41 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 41 Official Symbol ACCN2
Locus N/A Gene Type protein-coding
Synonyms ASIC; ASIC1; ASIC1A; BNaC2; hBNaC2
Full Name amiloride-sensitive cation channel 2, neuronal
Description amiloride-sensitive cation channel 2, neuronal
Chromosome 12q12
Also Known As Cation channel, amiloride-sensitive, neuronal, 2; acid-sensing ion channel 1a protein
Summary This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene is expressed in most if not all brain neurons, and it may be an ion channel subunit; however, its function as an ion channel remains unknown. Alternative splicing of this gene generates 2 transcript products. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37440

ID Symbol Protein Species
GeneID:41 ACCN2 NP_001086.2 Homo sapiens
GeneID:11419 Accn2 NP_033727.1 Mus musculus
GeneID:79123 Accn2 NP_077068.1 Rattus norvegicus
GeneID:171992 C24G7.4 NP_491293.1 Caenorhabditis elegans
GeneID:181468 flr-1 NP_510243.1 Caenorhabditis elegans
GeneID:182851 C24G7.1 NP_491296.1 Caenorhabditis elegans
GeneID:182852 C24G7.2 NP_491295.2 Caenorhabditis elegans
GeneID:182963 tag-324 NP_510463.2 Caenorhabditis elegans
GeneID:184882 F23B2.3 NP_501590.2 Caenorhabditis elegans
GeneID:185036 F28A12.1 NP_505230.1 Caenorhabditis elegans
GeneID:189051 T28F2.7 NP_491196.2 Caenorhabditis elegans
GeneID:407670 accn2c NP_999954.1 Danio rerio
GeneID:426883 ACCN2 NP_001035557.1 Gallus gallus
GeneID:451888 ACCN2 XP_001155207.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab65698 ACCN2 antibody (ab65698); Rabbit polyclonal to ACCN2
2 scbt ACCN2 ACCN2 Antibody / ACCN2 Antibodies;
3 sigma S7944 Anti-Sodium Channel ASIC1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACCN2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACCN2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0005886 Component plasma membrane
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0005509 Function calcium ion binding
GO:0005216 Function ion channel activity
GO:0005515 Function protein binding
GO:0031402 Function sodium ion binding
GO:0006816 Process calcium ion transport
GO:0006811 Process ion transport
GO:0009268 Process response to pH
GO:0007165 Process signal transduction
GO:0006814 Process sodium ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001095  UCSC Browser NP_001086 A3KN86   P78348  
2 NM_020039  UCSC Browser NP_064423

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000228468 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000228468 MI0000446 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000228468 MI0000470 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000228468 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENST00000228468 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000228468 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENST00000228468 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000228468 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENST00000228468 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000228468 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENST00000228468 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENST00000228468 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENST00000228468 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ACCN2 mRNA
17557909
Flavonoids
  • Flavonoids results in increased expression of ACCN2 mRNA
18035473
Paraquat
  • Paraquat results in increased expression of ACCN2 mRNA
17077588
Paraquat
  • Paraquat affects the expression of ACCN2 mRNA
15206577

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 11445065, 15451049, 16510128, 11124998, 16140633, 15824117, 11181820
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Inflammation inferred via Flavonoids 17296493
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16105132, 11677210, 15861022, 17333356, 16919318, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACCN2 ACCN2 / ACCN2 Invitro Gunthorpe MJ (2001)
PRKACA PRKACA / ACCN2 Biochemical Activity Leonard AS (2003)
PRKCABP PRKCABP / ACCN2 Affinity Capture-Western Hruska-Hageman AM (2002)
PRKCABP ACCN2 / PRKCABP Affinity Capture-Western Leonard AS (2003)
PRKCABP PRKCABP / ACCN2 Two-hybrid Hruska-Hageman AM (2002)
STOML1 STOML1 / ACCN2 Affinity Capture-Western Price MP (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sherwood TW, et al. (2008) "Endogenous arginine-phenylalanine-amide-related peptides alter steady-state desensitization of ASIC1a." J Biol Chem. 283(4):1818-1830. PMID:17984098
  2. [ + ] Donier E, et al. (2008) "Regulation of ASIC activity by ASIC4--new insights into ASIC channel function revealed by a yeast two-hybrid assay." Eur J Neurosci. 28(1):74-86. PMID:18662336
  3. [ + ] Carnally SM, et al. (2008) "Direct visualization of the trimeric structure of the ASIC1a channel, using AFM imaging." Biochem Biophys Res Commun. 372(4):752-755. PMID:18514062
  4. [ + ] Hettema JM, et al. (2008) "Lack of association between the amiloride-sensitive cation channel 2 (ACCN2) gene and anxiety spectrum disorders." Psychiatr Genet. 18(2):73-79. PMID:18349698
  5. [ + ] Cho JH, et al. (2007) "Potentiation of acid-sensing ion channels by sulfhydryl compounds." Am J Physiol Cell Physiol. 292(6):C2161-C2174. PMID:17392378
  6. [ + ] Chai S, et al. (2007) "A kinase-anchoring protein 150 and calcineurin are involved in regulation of acid-sensing ion channels ASIC1a and ASIC2a." J Biol Chem. 282(31):22668-22677. PMID:17548344
  7. [ + ] Lalo U, et al. (2007) "Spontaneous autocrine release of protons activates ASIC-mediated currents in HEK293 cells." J Cell Physiol. 212(2):473-480. PMID:17443677
  8. [ + ] Ye JH, et al. (2007) "Identification of acid-sensing ion channels in adenoid cystic carcinomas." Biochem Biophys Res Commun. 355(4):986-992. PMID:17324378
  9. [ + ] Ugawa S, et al. (2005) "Coexpression of vanilloid receptor subtype-1 and acid-sensing ion channel genes in the human trigeminal ganglion neurons." Chem Senses. 30 Suppl 1():i195. PMID:15738111
  10. [ + ] Shen L, et al. (2005) "Research on screening and identification of proteins interacting with ataxin-3." Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 22(3):242-247. PMID:15952105
  11. [ + ] Gitterman DP, et al. (2005) "Functional properties and pharmacological inhibition of ASIC channels in the human SJ-RH30 skeletal muscle cell line." J Physiol. 562(Pt 3):759-769. PMID:15576453
  12. [ + ] Wemmie JA, et al. (2004) "Overexpression of acid-sensing ion channel 1a in transgenic mice increases acquired fear-related behavior." Proc Natl Acad Sci U S A. 101(10):3621-3626. PMID:14988500
  13. [ + ] Poirot O, et al. (2004) "Selective regulation of acid-sensing ion channel 1 by serine proteases." J Biol Chem. 279(37):38448-38457. PMID:15247234
  14. [ + ] Price MP, et al. (2004) "Stomatin modulates gating of acid-sensing ion channels." J Biol Chem. 279(51):53886-53891. PMID:15471860
  15. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  16. [ + ] Jones NG, et al. (2004) "Acid-induced pain and its modulation in humans." J Neurosci. 24(48):10974-10979. PMID:15574747
  17. [ + ] Leonard AS, et al. (2003) "cAMP-dependent protein kinase phosphorylation of the acid-sensing ion channel-1 regulates its binding to the protein interacting with C-kinase-1." Proc Natl Acad Sci U S A. 100(4):2029-2034. PMID:12578970
  18. [ + ] Duggan A, et al. (2002) "The PDZ domain protein PICK1 and the sodium channel BNaC1 interact and localize at mechanosensory terminals of dorsal root ganglion neurons and dendrites of central neurons." J Biol Chem. 277(7):5203-5208. PMID:11739374
  19. [ + ] Wemmie JA, et al. (2002) "The acid-activated ion channel ASIC contributes to synaptic plasticity, learning, and memory." Neuron. 34(3):463-477. PMID:11988176
  20. [ + ] Hruska-Hageman AM, et al. (2002) "Interaction of the synaptic protein PICK1 (protein interacting with C kinase 1) with the non-voltage gated sodium channels BNC1 (brain Na+ channel 1) and ASIC (acid-sensing ion channel)." Biochem J. 361(Pt 3):443-450. PMID:11802773
  21. [ + ] Ji HL, et al. (2002) "Up-regulation of acid-gated Na(+) channels (ASICs) by cystic fibrosis transmembrane conductance regulator co-expression in Xenopus oocytes." J Biol Chem. 277(10):8395-8405. PMID:11748227
  22. [ + ] Berdiev BK, et al. (2002) "Protein kinase C isoform antagonism controls BNaC2 (ASIC1) function." J Biol Chem. 277(48):45734-45740. PMID:12244121
  23. [ + ] Ugawa S, et al. (2002) "Amiloride-blockable acid-sensing ion channels are leading acid sensors expressed in human nociceptors." J Clin Invest. 110(8):1185-1190. PMID:12393854
  24. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  25. [ + ] Bassler EL, et al. (2001) "Molecular and functional characterization of acid-sensing ion channel (ASIC) 1b." J Biol Chem. 276(36):33782-33787. PMID:11448963
  26. [ + ] Gunthorpe MJ, et al. (2001) "Characterisation of a human acid-sensing ion channel (hASIC1a) endogenously expressed in HEK293 cells." Pflugers Arch. 442(5):668-674. PMID:11512022
  27. [ + ] Askwith CC, et al. (2000) "Neuropeptide FF and FMRFamide potentiate acid-evoked currents from sensory neurons and proton-gated DEG/ENaC channels." Neuron. 26(1):133-141. PMID:10798398
  28. [ + ] Bubien JK, et al. (1999) "Malignant human gliomas express an amiloride-sensitive Na+ conductance." Am J Physiol. 276(6 Pt 1):C1405-C1410. PMID:10362604
  29. [ + ] Garcia-Anoveros J, et al. (1997) "BNaC1 and BNaC2 constitute a new family of human neuronal sodium channels related to degenerins and epithelial sodium channels." Proc Natl Acad Sci U S A. 94(4):1459-1464. PMID:9037075
  30. [ + ] Bassilana F, et al. (1997) "The acid-sensitive ionic channel subunit ASIC and the mammalian degenerin MDEG form a heteromultimeric H+-gated Na+ channel with novel properties." J Biol Chem. 272(46):28819-28822. PMID:9360943
  31. [ + ] Waldmann R, et al. (1997) "A proton-gated cation channel involved in acid-sensing." Nature. 386(6621):173-177. PMID:9062189
  32. [ + ] Corey DP, et al. (1996) "Mechanosensation and the DEG/ENaC ion channels." Science. 273(5273):323-324. PMID:8685718