accn2a | GeneID:407672 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 407672 Official Symbol accn2a
Locus N/A Gene Type protein-coding
Synonyms zASIC1.1
Full Name amiloride-sensitive cation channel 2 a
Description amiloride-sensitive cation channel 2 a
Chromosome N/A
Also Known As acid-sensing ion channel 1.1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 105980

ID Symbol Protein Species
GeneID:407672 accn2a NP_999956.1 Danio rerio
GeneID:477612 ACCN2 XP_850400.1 Canis lupus familiaris
GeneID:538244 LOC538244 XP_618443.3 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0005216 Function ion channel activity
GO:0005272 Function sodium channel activity
GO:0031402 Function sodium ion binding
GO:0006811 Process ion transport
GO:0006814 Process sodium ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_214791 NP_999956 B3DGD8   Q708S8  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000028603 MI0001873 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000028603 MI0001874 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000028603 MI0001371 dre-miR-192 AUGACCUAUGAAUUGACAGCC
ENSDART00000028603 MI0002029 dre-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSDART00000028603 MI0002030 dre-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSDART00000028603 MI0002031 dre-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSDART00000028603 MI0002036 dre-miR-196b UAGGUAGUUUCAAGUUGUUGGG
ENSDART00000028603 MI0001388 dre-miR-222 AGCUACAUCUGGCUACUGGGUCUC
ENSDART00000028603 MI0002072 dre-miR-375 UUUGUUCGUUCGGCUCGCGUUA
ENSDART00000028603 MI0002073 dre-miR-375 UUUGUUCGUUCGGCUCGCGUUA
ENSDART00000028603 MI0004771 dre-miR-727 GUUGAGGCGAGUUGAAGACUUA
ENSDART00000028603 MI0004868 xtr-miR-215 AUGACCUAUGAAAUGACAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Paukert M, et al. (2004) "A family of acid-sensing ion channels from the zebrafish: widespread expression in the central nervous system suggests a conserved role in neuronal communication." J Biol Chem. 279(18):18783-18791. PMID:14970195