accn1 | GeneID:407669 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 407669 Official Symbol accn1
Locus N/A Gene Type protein-coding
Synonyms zASIC2
Full Name amiloride-sensitive cation channel 1
Description amiloride-sensitive cation channel 1
Chromosome N/A
Also Known As acid-sensing ion channel 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 90965

ID Symbol Protein Species
GeneID:25364 Accn1 NP_001029186.1 Rattus norvegicus
GeneID:407669 accn1 NP_999953.1 Danio rerio
GeneID:419945 LOC419945 XP_418066.2 Gallus gallus
GeneID:617930 ACCN1 NP_001069952.1 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0005216 Function ion channel activity
GO:0005272 Function sodium channel activity
GO:0031402 Function sodium ion binding
GO:0006811 Process ion transport
GO:0006814 Process sodium ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_214788 NP_999953 B3DFR3   Q708S5  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000039517 MI0004771 dre-miR-727 GUUGAGGCGAGUUGAAGACUUA
ENSDART00000039517 MI0004923 xtr-miR-33b GUGCAUUGUUGUUGCAUUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Paukert M, et al. (2004) "A family of acid-sensing ion channels from the zebrafish: widespread expression in the central nervous system suggests a conserved role in neuronal communication." J Biol Chem. 279(18):18783-18791. PMID:14970195