accn4a | GeneID:407668 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 407668 Official Symbol accn4a
Locus DKEY-22P6.1 Gene Type protein-coding
Synonyms zASIC4.1
Full Name amiloride-sensitive cation channel 4 a
Description amiloride-sensitive cation channel 4 a
Chromosome N/A
Also Known As acid-sensing ion channel 4.1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11166

ID Symbol Protein Species
GeneID:55515 ACCN4 NP_061144.2 Homo sapiens
GeneID:63882 Accn4 NP_071570.1 Rattus norvegicus
GeneID:174069 degenerin NP_495302.2 Caenorhabditis elegans
GeneID:241118 Accn4 NP_898843.1 Mus musculus
GeneID:407667 accn4b NP_999951.1 Danio rerio
GeneID:407668 accn4a NP_999952.1 Danio rerio
GeneID:488537 ACCN4 XP_853306.1 Canis lupus familiaris
GeneID:743548 ACCN4 XP_001163732.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0005261 Function cation channel activity
GO:0005216 Function ion channel activity
GO:0005272 Function sodium channel activity
GO:0031402 Function sodium ion binding
GO:0006811 Process ion transport
GO:0006814 Process sodium ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_214787 NP_999952

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000032695 MI0001965 dre-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSDART00000032695 MI0001989 dre-miR-132* ACCGUGGCAUUAGAUUGUUACU
ENSDART00000032695 MI0001993 dre-miR-133a* AGCUGGUAAAAUGGAACCAAAU
ENSDART00000032695 MI0002012 dre-miR-146a UGAGAACUGAAUUCCAUAGAUGG
ENSDART00000032695 MI0002013 dre-miR-146b UGAGAACUGAAUUCCAAGGGUG
ENSDART00000032695 MI0002014 dre-miR-146b UGAGAACUGAAUUCCAAGGGUG
ENSDART00000032695 MI0001368 dre-miR-182* UGGUUCUAGACUUGCCAACUA
ENSDART00000032695 MI0003691 dre-miR-31 GGCAAGAUGUUGGCAUAGCUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Chen X, et al. (2007) "Zebrafish acid-sensing ion channel (ASIC) 4, characterization of homo- and heteromeric channels, and identification of regions important for activation by H+." J Biol Chem. 282(42):30406-30413. PMID:17686779
  2. [ + ] Paukert M, et al. (2004) "A family of acid-sensing ion channels from the zebrafish: widespread expression in the central nervous system suggests a conserved role in neuronal communication." J Biol Chem. 279(18):18783-18791. PMID:14970195