a2bp1l | GeneID:407613 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 407613 Official Symbol a2bp1l
Locus CH211-57K11.1 Gene Type protein-coding
Synonyms Fox-1; hm:zeh0082
Full Name ataxin 2-binding protein 1-like
Description ataxin 2-binding protein 1-like
Chromosome N/A
Also Known As RNA-binding protein; zeh0082
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005634 Component nucleus
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0003723 Function RNA binding
GO:0006397 Process mRNA processing
GO:0008380 Process RNA splicing

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_214775 NP_999940 B3DK66   Q7ZT82  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000027364 MI0001857 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000027364 MI0001858 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000027364 MI0001860 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000027364 MI0001861 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000027364 MI0001862 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000027364 MI0001863 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000027364 MI0001865 dre-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSDART00000027364 MI0001866 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000027364 MI0001867 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000027364 MI0001868 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000027364 MI0001870 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000027364 MI0001872 dre-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSDART00000027364 MI0001875 dre-let-7h UGAGGUAGUAAGUUGUGUUGUU
ENSDART00000027364 MI0001876 dre-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSDART00000027364 MI0003343 dre-let-7j UGAGGUAGUUGUUUGUACAGUU
ENSDART00000027364 MI0001966 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000027364 MI0001967 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000027364 MI0001968 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000027364 MI0001969 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000027364 MI0001970 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000027364 MI0001971 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000027364 MI0001980 dre-miR-128 UCACAGUGAACCGGUCUCUUUU
ENSDART00000027364 MI0001981 dre-miR-128 UCACAGUGAACCGGUCUCUUUU
ENSDART00000027364 MI0001369 dre-miR-183 UAUGGCACUGGUAGAAUUCACUG
ENSDART00000027364 MI0001880 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000027364 MI0001881 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000027364 MI0001883 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000027364 MI0001884 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000027364 MI0001885 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000027364 MI0004820 xtr-miR-98 UGAGGUAGUAAGUUGUAUUGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Jin Y, et al. (2003) "A vertebrate RNA-binding protein Fox-1 regulates tissue-specific splicing via the pentanucleotide GCAUG." EMBO J. 22(4):905-912. PMID:12574126
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  3. [ + ] Ton C, et al. (2000) "Identification, characterization, and mapping of expressed sequence tags from an embryonic zebrafish heart cDNA library." Genome Res. 10(12):1915-1927. PMID:11116087