5htr2c | GeneID:407134 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 407134 Official Symbol 5htr2c
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description 5-hydroxytryptamine 2C receptor
Chromosome N/A
Also Known As
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0004930 Function G-protein coupled receptor activity
GO:0004872 Function receptor activity
GO:0007186 Process G-protein coupled receptor protein signaling pathway
GO:0007165 Process signal transduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001254730 XP_001254731

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000030115 MI0004735 bta-miR-101 UACAGUACUGUGAUAACUGAA
ENSBTAT00000030115 MI0005014 bta-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSBTAT00000030115 MI0004746 bta-miR-27a UUCACAGUGGCUAAGUUCCG
ENSBTAT00000030115 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENSBTAT00000030115 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSBTAT00000030115 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSBTAT00000030115 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSBTAT00000030115 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENSBTAT00000030115 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENSBTAT00000030115 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSBTAT00000030115 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene