abcf1 | GeneID:406467 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 406467 Official Symbol abcf1
Locus CH211-215A10.2 Gene Type protein-coding
Synonyms wu:fb79c06; wu:fc39a05; wu:fj94a08; zgc:85667
Full Name ATP-binding cassette, sub-family F (GCN20), member 1
Description ATP-binding cassette, sub-family F (GCN20), member 1
Chromosome N/A
Also Known As ATP-binding cassette 50; ATP-binding cassette sub-family F, member 1; TNF-alpha stimulated ABC protein; fj94a08
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 849

ID Symbol Protein Species
GeneID:23 ABCF1 NP_001020262.1 Homo sapiens
GeneID:32112 CG1703 NP_572736.1 Drosophila melanogaster
GeneID:85493 Abcf1 XP_001062137.1 Rattus norvegicus
GeneID:179748 abcf-1 NP_506192.1 Caenorhabditis elegans
GeneID:224742 Abcf1 NP_038882.1 Mus musculus
GeneID:406467 abcf1 NP_998351.1 Danio rerio
GeneID:462543 ABCF1 NP_001035838.1 Pan troglodytes
GeneID:474826 ABCF1 XP_532056.2 Canis lupus familiaris
GeneID:525343 ABCF1 XP_603695.3 Bos taurus
GeneID:824619 ATGCN4 NP_567001.1 Arabidopsis thaliana
GeneID:1280440 AgaP_AGAP012249 XP_320293.2 Anopheles gambiae
GeneID:2539509 SPCC825.01 NP_588051.1 Schizosaccharomyces pombe
GeneID:4333216 Os03g0441500 NP_001050461.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_213186 NP_998351

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000048977 MI0001873 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000048977 MI0001874 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000048977 MI0001876 dre-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSDART00000048977 MI0001982 dre-miR-129* AAGCCCUUACCCCAAAAAGCAU
ENSDART00000048977 MI0001368 dre-miR-182* UGGUUCUAGACUUGCCAACUA
ENSDART00000048977 MI0001913 dre-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSDART00000048977 MI0001915 dre-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSDART00000048977 MI0001916 dre-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSDART00000048977 MI0002067 dre-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENSDART00000048977 MI0001720 dre-miR-429 UAAUACUGUCUGGUAAUGCCGU
ENSDART00000048977 MI0002176 dre-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSDART00000048977 MI0004784 dre-miR-738 GCUACGGCCCGCGUCGGGACCUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  2. [ + ] Sivasubbu S, et al. (2006) "Gene-breaking transposon mutagenesis reveals an essential role for histone H2afza in zebrafish larval development." Mech Dev. 123(7):513-529. PMID:16859902
  3. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856
  4. [ + ] Sambrook JG, et al. (2005) "A genome-wide survey of Major Histocompatibility Complex (MHC) genes and their paralogues in zebrafish." BMC Genomics. 6():152. PMID:16271140
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932