abce1 | GeneID:406324 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 406324 Official Symbol abce1
Locus N/A Gene Type protein-coding
Synonyms MGC56045; wu:fb34c09; wu:fe47b01; wu:fi09g07; zgc:111906; zgc:56045
Full Name ATP-binding cassette, sub-family E (OABP), member 1
Description ATP-binding cassette, sub-family E (OABP), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2205

ID Symbol Protein Species
GeneID:6059 ABCE1 NP_001035809.1 Homo sapiens
GeneID:24015 Abce1 NP_056566.2 Mus musculus
GeneID:39027 CG5651 NP_648272.1 Drosophila melanogaster
GeneID:176733 abce-1 NP_499717.1 Caenorhabditis elegans
GeneID:361390 Abce1 XP_001064797.1 Rattus norvegicus
GeneID:406324 abce1 NP_998216.1 Danio rerio
GeneID:422462 ABCE1 NP_001006440.1 Gallus gallus
GeneID:461523 ABCE1 XP_517465.1 Pan troglodytes
GeneID:475454 ABCE1 XP_532679.2 Canis lupus familiaris
GeneID:514991 ABCE1 XP_592921.3 Bos taurus
GeneID:813912 MAL13P1.344 XP_001350392.1 Plasmodium falciparum
GeneID:827661 ATRLI2 NP_193656.2 Arabidopsis thaliana
GeneID:851665 RLI1 NP_010376.1 Saccharomyces cerevisiae
GeneID:1269374 AgaP_AGAP002182 XP_308004.2 Anopheles gambiae
GeneID:2539753 SPBC14F5.06 NP_596732.1 Schizosaccharomyces pombe
GeneID:2677986 MGG_11382 XP_362155.2 Magnaporthe grisea
GeneID:2712409 NCU03061.1 XP_330497.1 Neurospora crassa
GeneID:2891913 KLLA0C17556g XP_452984.1 Kluyveromyces lactis
GeneID:4350692 Os11g0546000 NP_001068062.1 Oryza sativa
GeneID:4623093 AGOS_AGR125W NP_986791.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab32270 ABCE1 antibody (ab32270); Rabbit polyclonal to ABCE1

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0009055 Function electron carrier activity
GO:0051536 Function iron-sulfur cluster binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_213051 NP_998216
2 NM_213553 NP_998718

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000015777 MI0002026 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000015777 MI0003243 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000015777 MI0001373 dre-miR-199* UACAGUAGUCUGCACAUUGGUU
ENSDART00000015777 MI0001374 dre-miR-199* UACAGUAGUCUGCACAUUGGUU
ENSDART00000015777 MI0001389 dre-miR-223 UGUCAGUUUGUCAAAUACCCC
ENSDART00000015777 MI0002063 dre-miR-338 UCCAGCAUCAGUGAUUUUGUUG
ENSDART00000015777 MI0002064 dre-miR-338 UCCAGCAUCAGUGAUUUUGUUG
ENSDART00000015777 MI0002065 dre-miR-338 UCCAGCAUCAGUGAUUUUGUUG
ENSDART00000015777 MI0002066 dre-miR-338 UCCAGCAUCAGUGAUUUUGUUG
ENSDART00000015777 MI0004882 xtr-miR-425-5p AAUGACACGAUCACUCCCGUUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  2. [ + ] Harden MV, et al. (2006) "Olfactory imprinting is correlated with changes in gene expression in the olfactory epithelia of the zebrafish." J Neurobiol. 66(13):1452-1466. PMID:17013923
  3. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  4. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856
  5. [ + ] Amsterdam A, et al. (2004) "Identification of 315 genes essential for early zebrafish development." Proc Natl Acad Sci U S A. 101(35):12792-12797. PMID:15256591
  6. [ + ] Song HD, et al. (2004) "Hematopoietic gene expression profile in zebrafish kidney marrow." Proc Natl Acad Sci U S A. 101(46):16240-16245. PMID:15520368
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932